a new approach to the problem
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing...
- 8
- 522
- 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... from the Sandia National Laboratory study on enter-prise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into ... one hand, the manager is told that wasting the tax-payers’ dollars must stop; on the other hand, the public manager is told to do more with less. A cry heard around the globe is that government ... appropriate transforma-tion perspectives. ese are the philosophical underpinnings of change initiatives, and they serve as approaches to framing the planned change to fit into the technical and...
- 288
- 2,415
- 0
A New Approach to Quantum Theory
... there was a great obstacle to this delayedaction-at -a- distance theory: namely, if a radiating electron, say inan atom or an antenna, were not acted upon at all by the field thatit radiated, then ... leaves the action invariant(for example, the transformation may be a rotation). The trans-formation is to contain a parameter, a, and is to be a continuousfunction of a. Fora equal to zero, the ... radiationof an atom in quantum mechanics also, may not be spontaneousat all, but induced by the interaction with other atoms, and thatall of the apparent quantum properties of light and the...
- 142
- 574
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and the study of language universals. ... Nga – K 1 1A 30Graduation paperDeclarationTitle: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... 2.2.2 Gradable and non- gradable adjectivesAccording to L. G. Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable. Gradable adjectives mean a large class of...
- 44
- 1,746
- 7
Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc
... judgment, all words in the upper branch of the hierarchical tree are related to the hand sense of palm, and all other words are related to its tree sense. However, it is somewhat unsatis-factory ... consid-ered as one of its senses. A problem that we see with this approach is that it allows only as many senses as clusters, thereby limiting the granularity of the meaning space. This problem is avoided ... practical purposes, we can not claim that our algorithm is capable of finding all the fine grained distinctions that are listed in manually created dictionaries such as the Longman Dictionary...
- 4
- 536
- 0
Partnering: A New Approach to Sexual and Reproductive Health doc
... perspectives: the father as symbolic function, the father as a legalinstitution and the father as a biological fact. The first refers to the psychological, tra d i t i o n a l ,c u l t u ral and historical ... “implies a positive approach to human sexuality” and mandates that sexualhealth care should be the enhancement of life and personal relationships and not merely the counselling and care related to ... communication, 20 October 2000. Chapter 1S The Masculinity EquationPartnering: A New Approach to Sexual and Reproductive Health, 2001, Technical Paper No .3, UNFPA, New YorkPartnering: A New Approach...
- 196
- 505
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation ofhigh molecular mass...
- 11
- 731
- 0
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx
... tool.3Or˘asan et al. (2000) enhanced the preference-based anaphora resolution algorithmsby using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the opti-mal combination ... Extractor), a new approach to multilingualsingle-document extractive summarization wheresummarization is considered as an optimization or a search problem. We use a Genetic Algorithm(GA) to ... not be applied too often,because then GA will in fact change to randomsearch. Our mutation operator includes a proba-bility (3%) that an arbitrary weight in a vector willbe changed by a uniformly...
- 10
- 598
- 0
Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf
... vector comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate alge-braic method that has the capability to reduce ... salient. Also, widely and rural are well within the adjective cluster. The comparison of the two dendrograms indicates that the SVD was capable of making ap-propriate generalizations. Also, when ... after adding one to each value in the matrix.2 As usual, the one is added for smoothing purposes and to avoid problems with zero values. We de-cided not to use a sophisticated association meas-ure...
- 4
- 433
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
... Evaluation, pages 719- 724. Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto Nagao. 1998. Construction of Japanese nominal semantic dictionary using " ;A ... a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus word for a head word, like a person ... 'book-Ace' yomu 'read' Agent senmonka 'expert' no chousa 'study' kare-ga 'he-NOM' yomu 'read' Possession watashi 'I' no kuruma...
- 8
- 553
- 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx
... required to resolve the interactions and to further contribute to the understanding of paper as a material. In this thesis a new outlook to fibre bonding and paper strength was adopted in order to ... layer. The sensor is a quartz crystal that oscillates at a certain resonant frequency (f0). The frequency changes on adsorption to a lower value (f), as the coupled mass on the surface increases. ... formation (Swanson 1950). Guar gum is a branched galactomannan polymer which has a linear 1-4 ȕ-D-mannan backbone with 1-6-linked Į-D-galactose side groups on approximately every second mannose...
- 89
- 701
- 1
A new approach to Internet banking by Matthew Johnson pdf
... ‘visual cryptogram’ [100]containing details of the transaction and an authentication code to be copied back to the bank.As with CAP the presence of part of the transaction details is a big advan-tage ... the real bank and the transaction challengesand responses are forwarded between the real bank and the user, but the transac-tion details are altered to transfer funds to the attacker instead. ... heuristic classifiers work badly against an adap-tive adversary who can test attacks against the classifier and refine them beforerelease. Tuning heuristics can also be very difficult, in particular adjusting...
- 113
- 471
- 0
- a new approach to the maximum flow problem
- a new approach to the shaded picture problem
- a new approach to the giant component problem
- a new approach to the surface intersection problem
- a new approach to the conjugacy problem in garside groups
- a new approach to the implementation problem
- a new approach to the gagging problem
- a new approach to the problem of human interrelations
- who shall survive a new approach to the problem of human interrelations
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ