a new approach to the implementation problem
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
Ngày tải lên :
08/03/2014, 18:20
...
behavior of the morphological and syntactic
parsers on a more complicated example:
Ngarrka-ngku.ka marlu marna-kurra luwa.rnu
ngarni.nja-kurra (man-ergative-aux kangaroo
grass-obj shoot-past ... namely prosody and the non-
isomorphism of syntactic and phonological
structure. We maintain that these are are
central to the task of a morphological analyzer
and, hence, have incorporated ... 07974.
Barbara Brunson*
AT&T Bell Laboratories
and
Department of Linguistics
University of Toronto
Toronto, Ontario, Canada M5S 1A1 .
Abstract
We present a model of morphological
processing...
- 8
- 522
- 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
Ngày tải lên :
15/02/2014, 20:20
... from the Sandia National Laboratory study on enter-
prise transformation serves to bring the dangers that managers and administrators
face when attempting to impose a transformational change into ... one hand, the manager is told that wasting the tax-
payers’ dollars must stop; on the other hand, the public manager is told to do more
with less. A cry heard around the globe is that government ... appropriate transforma-
tion perspectives. ese are the philosophical underpinnings of change initiatives,
and they serve as approaches to framing the planned change to fit into the technical
and...
- 288
- 2.4K
- 0
A new approach to financial regulation: the blueprint for reform potx
Ngày tải lên :
29/03/2014, 18:20
... recognising that the regulators are best placed to determine the nature of
the regulatory action which should be taken. The same arrangements will also apply to the FCA.
Governance
2.68 As with the ... refers to the PRA’s assessment of
the risk to financial stability as a whole. It is likely that the PRA will consult the FPC in making
this assessment. Condition (b) allows the PRA to veto the action ... ensure that the powers available under the Part 18 regime can be used
more efficiently and that the FCA (and the Bank in relation to RCHs) can act more responsively to
the more complex and challenging...
- 413
- 413
- 0
A New Approach to Quantum Theory
Ngày tải lên :
06/11/2012, 11:21
... there was a great obstacle to this delayed
action-at -a- distance theory: namely, if a radiating electron, say in
an atom or an antenna, were not acted upon at all by the field that
it radiated, then ... leaves the action invariant
(for example, the transformation may be a rotation). The trans-
formation is to contain a parameter, a, and is to be a continuous
function of a. Fora equal to zero, the ... radiation
of an atom in quantum mechanics also, may not be spontaneous
at all, but induced by the interaction with other atoms, and that
all of the apparent quantum properties of light and the...
- 142
- 574
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
Ngày tải lên :
10/04/2013, 14:46
... fact, C .A has had
much to offer not only to practical language but also to translation theory, the
description of particular language, language typology and the study of language
universals. ... Nga – K 1 1A
30
Graduation paper
Declaration
Title: A new approach to semantic and syntactic
functions of English adjectives A contrastive–
analysis with their Vietnamese equivalents
(Graduation ... 2.2.2 Gradable and non- gradable adjectives
According to L. G. Alexander (1988, 108) adjectives can be also
divided into gradable and non- gradable.
Gradable adjectives mean a large class of...
- 44
- 1.7K
- 7
Partnering: A New Approach to Sexual and Reproductive Health doc
Ngày tải lên :
05/03/2014, 16:20
... perspectives: the father as symbolic function, the father as a legal
institution and the father as a biological fact. The first refers to the psychological, tra d i t i o n a l ,
c u l t u ral and historical ... “implies a positive approach to human sexuality” and mandates that sexual
health care should be the enhancement of life and personal relationships and not merely the
counselling and care related to ... communication, 20 October 2000.
Chapter 1
S
The Masculinity Equation
Partnering: A New Approach to Sexual and Reproductive Health, 2001, Technical Paper N
o .
3, UNFPA, New York
Partnering: A New Approach...
- 196
- 505
- 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
Ngày tải lên :
07/03/2014, 09:20
... CCCCATGTCGCCTTTAGT
OMCB-KO-R TCGCTAGAACACATTGAC
OMCA-F ATGATGAAACGGTTCAAT
OMCA-R TTAGTTACCGTGTGCTTC
OMCB-F CTGCTGCTCGCAGCAAGT
OMCB-R GTGTGATCTGCAACTGTT
OMCA-PBAD-F CACCGAGGAATAATAAATGATG
AAACGGTTCAATTTC
OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG
AAACGGTTCAATTTC
OMCA-PBAD-R TTAGTTACCGTGTGCTTC
OMCB-PBAD-F CACCGAGGAATAATAAATGATG
AACGCACAAAAATCA
OMCB-PBAD-R TTACATTTTCACTTTAGT
Shewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.
3736 ... used as a positive control to display omcA
(lane 1) and omcB (lane 6). DNA standards are indicated at the left
and right of the agarose gels. (B) Visualization and separation of
high molecular mass...
- 11
- 731
- 0
Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx
Ngày tải lên :
07/03/2014, 22:20
... tool.
3
Or
˘
asan et al. (2000) enhanced the
preference-based anaphora resolution algorithms
by using a GA to find an optimal set of values for
the outcomes of 14 indicators and apply the opti-
mal combination ... Extractor), a new approach to multilingual
single-document extractive summarization where
summarization is considered as an optimization or
a search problem. We use a Genetic Algorithm
(GA) to ... not be applied too often,
because then GA will in fact change to random
search. Our mutation operator includes a proba-
bility (3%) that an arbitrary weight in a vector will
be changed by a uniformly...
- 10
- 598
- 0
Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc
Ngày tải lên :
08/03/2014, 06:20
... Evaluation,
pages 719-
724.
Sadao Kurohashi, Masaki Murata, Yasunori
Yata, Mitsunobu Shimada, and Makoto
Nagao. 1998. Construction of Japanese
nominal semantic dictionary using " ;A ... a Japanese morphological analyzer,
and KNP, a Japanese syntactic and case ana-
lyzer (Kurohashi and Nagao, 1994; Kurohashi
and Nagao, 1998). Then, a genus word for a
head word, like
a person ... 'book-Ace' yomu 'read'
Agent senmonka 'expert' no chousa 'study' kare-ga
'he-NOM'
yomu 'read'
Possession watashi 'I' no kuruma...
- 8
- 553
- 0
Tìm thêm:
- hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam
- xác định các mục tiêu của chương trình
- xác định các nguyên tắc biên soạn
- khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn
- khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản
- khảo sát chương trình đào tạo gắn với các giáo trình cụ thể
- xác định thời lượng học về mặt lí thuyết và thực tế
- tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam
- điều tra đối với đối tượng giảng viên và đối tượng quản lí
- điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1
- khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam
- khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu
- nội dung cụ thể cho từng kĩ năng ở từng cấp độ
- xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct
- phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ
- mở máy động cơ lồng sóc
- mở máy động cơ rôto dây quấn
- các đặc tính của động cơ điện không đồng bộ
- hệ số công suất cosp fi p2
- đặc tuyến hiệu suất h fi p2