0

a new approach to the gagging problem

Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing...
  • 8
  • 522
  • 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Cao đẳng - Đại học

... from the Sandia National Laboratory study on enter-prise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into ... one hand, the manager is told that wasting the tax-payers’ dollars must stop; on the other hand, the public manager is told to do more with less. A cry heard around the globe is that government ... appropriate transforma-tion perspectives. ese are the philosophical underpinnings of change initiatives, and they serve as approaches to framing the planned change to fit into the technical and...
  • 288
  • 2,415
  • 0
A new approach to financial regulation: the blueprint for reform potx

A new approach to financial regulation: the blueprint for reform potx

Tài chính doanh nghiệp

... recognising that the regulators are best placed to determine the nature of the regulatory action which should be taken. The same arrangements will also apply to the FCA. Governance 2.68 As with the ... refers to the PRA’s assessment of the risk to financial stability as a whole. It is likely that the PRA will consult the FPC in making this assessment. Condition (b) allows the PRA to veto the action ... ensure that the powers available under the Part 18 regime can be used more efficiently and that the FCA (and the Bank in relation to RCHs) can act more responsively to the more complex and challenging...
  • 413
  • 413
  • 0
A New Approach to Quantum Theory

A New Approach to Quantum Theory

Khoa học tự nhiên

... there was a great obstacle to this delayedaction-at -a- distance theory: namely, if a radiating electron, say inan atom or an antenna, were not acted upon at all by the field thatit radiated, then ... leaves the action invariant(for example, the transformation may be a rotation). The trans-formation is to contain a parameter, a, and is to be a continuousfunction of a. Fora equal to zero, the ... radiationof an atom in quantum mechanics also, may not be spontaneousat all, but induced by the interaction with other atoms, and thatall of the apparent quantum properties of light and the...
  • 142
  • 574
  • 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Khoa học xã hội

... fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and the study of language universals. ... Nga – K 1 1A 30Graduation paperDeclarationTitle: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... 2.2.2 Gradable and non- gradable adjectivesAccording to L. G. Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable. Gradable adjectives mean a large class of...
  • 44
  • 1,746
  • 7
Partnering: A New Approach to Sexual and Reproductive Health doc

Partnering: A New Approach to Sexual and Reproductive Health doc

Sức khỏe phụ nữ

... perspectives: the father as symbolic function, the father as a legalinstitution and the father as a biological fact. The first refers to the psychological, tra d i t i o n a l ,c u l t u ral and historical ... “implies a positive approach to human sexuality” and mandates that sexualhealth care should be the enhancement of life and personal relationships and not merely the counselling and care related to ... communication, 20 October 2000. Chapter 1S The Masculinity EquationPartnering: A New Approach to Sexual and Reproductive Health, 2001, Technical Paper No .3, UNFPA, New YorkPartnering: A New Approach...
  • 196
  • 505
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation ofhigh molecular mass...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A new Approach to Improving Multilingual Summarization using a Genetic Algorithm" pptx

Báo cáo khoa học

... tool.3Or˘asan et al. (2000) enhanced the preference-based anaphora resolution algorithmsby using a GA to find an optimal set of values for the outcomes of 14 indicators and apply the opti-mal combination ... Extractor), a new approach to multilingualsingle-document extractive summarization wheresummarization is considered as an optimization or a search problem. We use a Genetic Algorithm(GA) to ... not be applied too often,because then GA will in fact change to randomsearch. Our mutation operator includes a proba-bility (3%) that an arbitrary weight in a vector willbe changed by a uniformly...
  • 10
  • 598
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học

... Evaluation, pages 719- 724. Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto Nagao. 1998. Construction of Japanese nominal semantic dictionary using " ;A ... a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus word for a head word, like a person ... 'book-Ace' yomu 'read' Agent senmonka 'expert' no chousa 'study' kare-ga 'he-NOM' yomu 'read' Possession watashi 'I' no kuruma...
  • 8
  • 553
  • 0

Xem thêm