0
  1. Trang chủ >
  2. Mẫu Slide >
  3. Mẫu Slide - Template >

Formation of metamorphic rocks

Báo cáo

Báo cáo " Ar‐Ar age of metamorphic and mylonitic rocks in northern part of the Kon Tum massif: evidence for the Indosinian movement along shear zones between Kon Tum massif and Truong Son belt " doc

... deformation and results of Ar‐Ar dating in this  area  in order  to  constrain  in detail  the spatial  metamorphic evolution  and interpretation  of geodynamic setting of the Indochina.   ... inside this zone, so this W‐E metamorphic shear zone  could  be  representative  for the main  tectonic  boundary  between Kon Tum metamorphic massif and non metamorphic Truong Son belt during Indosinian movement.   ... Thi,  and Nguyen  Van  Vuong,  The Early  Triassic  Indosinian orogeny  in Vietnam  (Truong Son belt and Kon Tum massif) : implications for the geodynamic evolution  of Indochina, Tectonophysics 393 (2004) 87. ...
  • 12
  • 531
  • 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling adequate ... decided the control strategy for the selection of well-settling sludge Then, we applied the strategy to the formation of aerobic granular sludge in a continuous experiment In addition, the effect of...
  • 8
  • 481
  • 0
Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx

Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx

... Ex : brother-in-law => brothers-in-law Passer-by => passers by ...
  • 2
  • 424
  • 0
Tài liệu NASA’S MANAGEMENT OF MOON ROCKS AND OTHER ASTROMATERIALS LOANED FOR RESEARCH, EDUCATION, AND PUBLIC DISPLAY doc

Tài liệu NASA’S MANAGEMENT OF MOON ROCKS AND OTHER ASTROMATERIALS LOANED FOR RESEARCH, EDUCATION, AND PUBLIC DISPLAY doc

... REPORT NO IG-12-007 DECEMBER 8, 2011 OVERVIEW NASA’S MANAGEMENT OF MOON ROCKS AND OTHER ASTROMATERIALS LOANED FOR RESEARCH, EDUCATION, AND PUBLIC DISPLAY The Issue Materials originating from extraterrestrial ... Affairs Office Figure Management and Distribution of Astromaterials for Research, Education, and Public Display NASA Office of Education NASA Science Mission Directorate NASA Office of Communications ... practices and update its policies for loans of astromaterials for education and public display purposes NASA’s Controls over Research Loans of Astromaterials Are Inadequate The Curation Office does...
  • 46
  • 466
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that finally ... context of macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading to the maturation of the cytochrome bc1 complex in the inner mitochondrial...
  • 15
  • 639
  • 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The effect of sulfate (.) concentration on the ... eukaryotic c class cytochromes [27]; anions exert a strong influence on the lysine residues of cytochrome c, and significantly affect the structure and the functional properties of the protein, as the conserved...
  • 11
  • 487
  • 0
Tài liệu Báo cáo khoa học: Oxidation inhibits amyloid fibril formation of transthyretin ppt

Tài liệu Báo cáo khoa học: Oxidation inhibits amyloid fibril formation of transthyretin ppt

... and the kinetics of fibril formation of these oxidized proteins reveal the amino acid interactions that are critical in the onset of amyloidogenesis The rates of amyloid fibril formation for WT ... confirm that Oxidation inhibits amyloid fibril formation of TTR the methionine residues of WT TTR and V30M TTR are highly reactive toward oxidative modification The inhibition effects of fibril formation ... in the onset of amyloid fibril formation Alternatively, the inhibition of fibril formation may purely be the result of an increase in solubility of oxidized proteins [6,41] Limited oxidation increases...
  • 7
  • 425
  • 0
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf

... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... 2005 FEBS 1709 Novel aggregate formation of an alkaline phosphatase frame-shift mutant A K Komaru et al C 3000 2500 Alkaline phosphatase activity Alkaline phosphatase (unit/mg protein or ml) 3000 ... hypophosphatasia, undergoes polyubiquitination prior to the degradation in the proteasome in the transfected COS-1 cells This 1707 Novel aggregate formation of an alkaline phosphatase frame-shift mutant...
  • 14
  • 445
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon ... upstream to the las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as plasmid vector for site-specific integration of extra gene...
  • 12
  • 616
  • 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx

... for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic domain, ... types of homodimers The insert within the catalytic domain is of importance for complex formation No functional significance has previously been ascribed to the insert between Asp and His of the ... to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity Even though the exact mechanism for complex formation and activation of...
  • 6
  • 520
  • 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot

... calculated and reported, such as the average a4v in each hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... set of 23 well-known amyloidogenic proteins and (c) guidance towards applying this software as a useful tool for improving the solubility of recombinant proteins and for controlling the formation ... there are three scales which allow the prediction of amyloidogenic regions in a protein sequence (or rather, the ability of a peptide to be amyloidogenic): the scale of the packing density, and...
  • 8
  • 415
  • 0
Báo cáo khoa học: Lysophosphatidylcholine modulates fibril formation of amyloid beta peptide doc

Báo cáo khoa học: Lysophosphatidylcholine modulates fibril formation of amyloid beta peptide doc

... influences fibril formation of Ab(1-40) and Ab(1-42) LPC modulates Ab fibril formation Results Effects of LPC on Ab(1-42) fibril formation To investigate the effects of LPC on Ab(1-42) fibril formation, ... the fibril formation process reached a plateau within h (Fig 1F) Effects of LPC on Ab(1-40) fibril formation Next, we investigated the fibrillogenic properties of Ab(1-40) Significant fibril formation ... during fibril formation of these two peptides However, as we did not investigate Ab(1-40) fibrillogenesis in the presence of higher concentrations of non-vesicular and vesicular LPC, a fibril formation- enhancing...
  • 9
  • 423
  • 0
Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx

Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx

... 5982–5993 ª 2008 The Authors Journal compilation ª 2008 FEBS 5983 Formation of amyloid beta oligomers by prefoldin M Sakono et al the presence of PFD were also separated by native PAGE and then subjected ... supports formation of a complex between PFD and Ab oligomers Toxicity of Ab oligomers Soluble Ab oligomers are highly cytotoxic and are found in AD brains, and are therefore considered to be the causative ... Examples of the Ab particles shown in (B) Scale bar = 50 nm ined the cytotoxicity of soluble Ab oligomers produced by the addition of PFD Ab aggregates of various concentrations were added to the...
  • 12
  • 385
  • 0
Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx

Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx

... (200 7) 3877–3885 ª 2007 The Authors Journal compilation ª 2007 FEBS (R) (R) (R) (R) (R) (R) (R) (R) (R) (R) (S) 3879 New application of firefly luciferase D.-I Kato et al ibuprofen, ketoprofen, ... and ee of the recovered acid (ee(s )) according to the equation: E ¼ ln[(1 ) c)(1 ) ee(s )) ] ⁄ ln[(1 ) c)(1 + ee(s )) ] [27] Entry Conversion ( %) Recovered acid (% yield) ee ( %) E -value 24.7 39.0 61.8 ... to the basic region Fig pH activity profile of LUC-H catalyzed thioester formation (s) and bioluminescent reaction (d) The activity of thioester formation was determined by the comparison with the...
  • 9
  • 477
  • 0

Xem thêm

Từ khóa: classification of metamorphic rocksprograde metamorphism of shale and the classification of metamorphic rockstexture and classification of metamorphic rocksformation of the first stable continental rocksigneous sedimentary or other metamorphic rocks as they are pushed down toward the heat of the mantleformation of the pluralthe formation of volcanoesrules for the formation of plural nounsrules in the formation of plural and possessive nounsthe formation of plural society in malaysiaformation of the plural of the nounformation of the plural in englishformation of the plural exercisesformation of partial differential equation pptformation of plural society in malaysiaNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ