0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Genetic studies on a soil streptomyces sp that produces an antifungal compoud

Genetic studies on a soil streptomyces sp  that produces an antifungal compoud

Genetic studies on a soil streptomyces sp that produces an antifungal compoud

... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate ... at a ‘transition stage’ as biomass changes from the quasi-exponential toward the stationary phase It has been suggested that such timing of antibiotic production and differentiation is adaptive...
  • 232
  • 455
  • 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high scalability but low adaptability ... VIETNAM NATIONAL UNIVERSITY, HANOI COLLEGE OF TECHNOLOGY TRAN NAM KHANH SOME STUDIES ON A PROBABILISTIC FRAMEWORK FOR FINDING OBJECT-ORIENTED INFORMATION IN UNSTRUCTURED DATA UNDERGRADUATE THESIS...
  • 51
  • 393
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] The surE gene duplicated ... phosphate concentrations are high 5862 Materials and methods Cloning and purification of St SurE The SurE gene was PCR amplified from Salmonella enterica Typhimurum strain IFO12529 genomic DNA as...
  • 10
  • 553
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and LPS-II (well 2) of C braakii PCM 1531, and LPS of Citrobacter ... inhibition of passive haemagglutination, SDS/ PAGE and immunoblotting using O-antisera against C braakii PCM 1531 and PCM 1487 In double immunodiffusion (Fig 4), the LPS of C braakii PCM 1531 and PCM...
  • 7
  • 478
  • 0
Indentation studies on a zr based bulk metallic glass

Indentation studies on a zr based bulk metallic glass

... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to characterize multiaxial plastic deformation of BMGs at ... of bulk metallic glasses Keywords: Bulk metallic glass, Mechanical properties, Hardness, Shear band, Spherical indentation, Nanoindentation vi List of Tables 2-1 Alloy systems, years and maximum...
  • 119
  • 390
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... substrate recognition For the superposition of the substrate- free PhyK with substrate- free ˚ AppA the Ca atoms are 2.41 A apart, whereas for the substrate- free PhyK and the substrate- loaded AppA ... B Fig Crystal structure of Klebsiella sp ASR1 phytase (A) Cartoon representation showing the two domains of PhyK, the a domain (orange) and the a ⁄ b domain (green) The disulfide bridges are represented ... the amino acid sequence of E coli glucose-1phosphatase (G1P) is related to AppA, the crystal structure suggests that phytate can bind to the active site of G1P only in an orientation with the...
  • 13
  • 766
  • 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... ensure the generation of the ketone The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was examined under the same conditions In the case of ZmPDC maximum enzyme concentration was 2.3 ... independent of the concentration of the auxiliary enzyme, confirming that the coupled assay monitors the true rate of EcIPDC catalysis Figs and and Table illustrate the results of the steady-state kinetics ... indole- 3 -acetic acid biosynthesis of Enterobacter cloacae Biochim Biophys Acta 1209, 241–247 Koga, J (1995) Structure and function of indolepyruvate decarboxylase, a key enzyme in indole 3 -acetic acid...
  • 10
  • 430
  • 0
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx

Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx

... Function of SP isoform of type III AFP M Takamichi et al isoforms with respect to the TH value has been identified [6–8] For example, an AFGP based on a repetitive polypeptide consisting of Thr–Ala–Ala ... successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice bipyramid, as illustrated in Fig When pyramidal planes are created by the adsorption of AFPs, the ... Function of SP isoform of type III AFP M Takamichi et al Measurement of ice growth rate and TH activity Ice crystal morphology was observed and the crystal growth rate was measured for solutions of...
  • 9
  • 289
  • 0
Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

... that the Kdn-containing polymer, along with teichuronic and teichoic acids is a constituent of the cell wall of plant pathogenic strain Streptomyces sp VKM Ac-2124, which is phylogenetically the ... of the total cell wall preparation was determined by its transformation in 2-octyl glycoside and by comparison of the derivative obtained with standard samples of (S+ )and (R-)-2-octyl glucopyranosides ... bootstrap analysis of the sequence data with the same software To evaluate the pathogenic activity of the strain, the aseptically cultured potato microtubers in vitro were used as described by Lawrence...
  • 6
  • 561
  • 0
Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

Báo cáo khoa học: Kinetic studies on endo-b-galactosidase by a novel colorimetric assay and synthesis of N -acetyllactosamine-repeating oligosaccharide b-glycosides using its transglycosylation activity pptx

... in this work (A) Consecutive additions of GlcNAc and Gal to Galb1-4GlcNAcb-pNP by b3GnT and b4GalT (B) Consecutive additions of GlcNAc and Gal to Galb1-4Glcb-pNP by b3GnT and b-D-galactosidase ... of that of The same tendency was seen in a comparison of and This was also the case for B fragilis endo-b-galactosidase as shown in Table Transglycosylation reaction of endo-b-galactosidase from ... transglycosylation and time courses of the production of transglycosylation products and 10 from and degradation of (A) HPLC analysis was performed as described in Materials and methods (B) A reaction mixture...
  • 11
  • 365
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article 60 GHz Indoor Propagation Studies for Wireless Communications Based on a Ray-Tracing Method" docx

... [10] N Moraitis and P Constantinou, Indoor channel measurements and characterization at 60 GHz for wireless local area network applications,” IEEE Transactions on Antennas and Propagation, vol ... Selected Areas in Communications, vol 20, no 3, pp 620–630, 2002 [3] T Manabe, Y Miura, and T Ihara, “Effects of antenna directivity and polarization on indoor multipath propagation characteristics at ... RMS delay spread MODELING OF ROOM AND HALLWAY For our 60 GHz propagation studies, of particular interest was the effect of wall configuration on the channel parameters and the fading statistics...
  • 6
  • 274
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " Soil and plant communities development and ecological effectiveness of reclamation on a sand mine cast" ppt

... loading rate and sawdust additions on row crop yield and nitrate leaching potentials in Virginia sand and gravel mine reclamation Land Reclamation A Different Approach In: Proceedings 18th National ... PIETRZYKOWSKI M., KRZAKLEWSKI W., 2007 Soil organic matter, C and N accumulation during natural succession and reclamation in an opencast sand quarry (southern Poland) Archives of Agronomy and Soil Science, ... Table Shannon diversity index 'H' and abundance of species (number of species) in plant communities depending on the age and category of areas in the Szczakowa sand mine cast Age of areas (years)...
  • 12
  • 411
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " On the niche breadth of Fagus sylvatica: soil nutrient status in 50 Central European beech stands on a broad range of bedrock types" potx

... larger differences among the sites than actually exist in the main rooting horizon A major disadvantage of our study is the lack of appropriate data on N availability in the soils Although N mineralization ... in the basic calcareous substrates than in the acidic sandstone and sandy soils (Tab III) The pool of exchangeable Ca + Mg + K in the mineral topsoil was very small in the glacial sandy and loamy ... ratio of the mineral soil, and N/P ratio of the organic layer for differentiating the 50 beech forests in terms of their soil nutrient status The PCA separated the main geological substrates along...
  • 14
  • 382
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A generic model of forest canopy conductance dependent on climate, soil water availability and leaf area index" potx

... root zone, Wm is the minimum soil water (i.e lower limit of water availability) , WFC is the soil water content at field capacity 2.2 Calculation of canopy conductance Canopy conductance for water ... have demonstrated the negative effect of soil water depletion on canopy conductance Variation of gc can be related either to predawn water potential as in [32], to soil water reserve or soil water ... leaves of different ages in coniferous species, etc.), submitted to differing environmental conditions [29] A model of forest canopy conductance 763 Figure Variation of relative canopy conductance...
  • 11
  • 360
  • 0

Xem thêm

Từ khóa: communication device a rarely used term that describes an inputdiscuss the operation that can be carried out on a processturibaka kibun a game that would only be possible on a mobile phone1990 165 there are four factors that affect language test scores the effects of these various factors on a test score can be illustrated as in figure 2 2therefore the company shall not prepare its annual accounts on a going concern basis if management determines even after the balance sheet date that it intends to liquidate the company or cease trading or that it has no realistic alternative but to do soa typical policy flow chart grid that you might create on a whiteboardmucin methods genes encoding mucins and their genetic variation with a focus on gel forming mucinswriting code that processes data entered on a formintroduction overview of studies on genetic and environmental factors involved in lung cancer susceptibilitya 16 bit number that identifies a specific program on the serverstudies of therapeutic strategies for atrial fibrillation based on a biophysical model of the human atriapurse a value that may be stored on a smartcard and represents thescreen display a display that is not based on a crt cathode raydon t forget that preventing back problem by a proper sitting position on a proper desk is the best politya company has announced that it wishes to build a large factory near your community discuss the advantages and disadvantages of this new influence on your community do you support or oppose the factory explain your positionBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP