therefore the company shall not prepare its annual accounts on a going concern basis if management determines even after the balance sheet date that it intends to liquidate the company or cease trading or that it has no realistic alternative but to do so
Corporations: Paid-in Capital and the Balance Sheet pot
... separation of ownership and management corporate taxation government regulation Organizing a Corporation • The process of creating a corporation begins when the organizers (incorporators) obtain ... obtain a charter from the state • The charter authorizes the corporation to issue stock and conduct business in accordance with state law and the corporation’s bylaws Organizing a Corporation • Stockholders ... board of directors alone has the authority to declare a dividend Dividend Dates Three relevant dates for dividends are: Declaration date Date of record Payment date Objective Account for Cash...
- 48
- 365
- 0
The Balance Sheet and Financial Disclosures pptx
... fiscal year-end but before the financial statements are issued Noteworthy Events and Transactions Transactions or events that are potentially important to evaluating a company s financial statements, ... assets and liabilities Identify and describe the various balance sheet asset classifications 3-6 FedEx Corporation Balance Sheet 31-May Assets are probable future economic benefits obtained or ... appropriate corresponding total, or base amount, within the same year Horizontal Analysis Vertical Analysis Allows analysts to control for size differences over time and among firms Ratio Analysis...
- 13
- 225
- 0
THE BALANCE SHEET POCKET BOOK phần 1 pps
... rises it has more money’ ◆ If I compare the results of two businesses, the one which has made more profit has done better’ ◆ The accountant balances the Balance Sheet by entering a balancing ... seem familiar ◆ The Balance Sheet tells me the value of the business’ ◆ ‘At the year-end the retained profit must be somewhere; in the bank, or the accountant’s drawer’ ◆ If the company s share ... operating profit, financing costs, published format CLASSIFICATION OF EXPENDITURE Why classify? Capital or Revenue? control THE BALANCE SHEET Use of Funds (Fixed Assets, Working Capital), Source...
- 10
- 339
- 0
THE BALANCE SHEET POCKET BOOK phần 2 potx
... ‘profits’ it has the opportunity to plough back some of the money it has made to self-finance its future growth ● Retained profit is money the business has made itself ● It is therefore the cheapest ... the company s share price rises it has more money If it falls, it has less.’ Apart from when the company wishes to raise new share capital or is warding off a takeover bid, the share price has no ... security or collateral (so that the loan can be recovered if the borrower defaults) THE BUSINESS FINANCIAL MODEL SOURCE OF FUNDS LOAN CAPITAL - EXAMPLE Taking out a mortgage is a similar process to...
- 10
- 305
- 0
THE BALANCE SHEET POCKET BOOK phần 3 pps
... in Working Capital? ● Not all the stock will have been paid for Therefore Working Capital is the value of Current Assets less the amount owed to suppliers: WORKING CAPITAL = CURRENT ASSETS less ... despatched to the customer This timing difference is one of the factors contributing to the outcome that PROFIT CASH ≠ CASH RAW MATERIALS DEBTORS/ RECEIVABLES PR SAL ES OF R P ● SH CA SA Cash ... this working capital and that is exactly what the investment has to WORK! ● Cash is used to buy Raw Materials, which are converted into Work in Progress, and through to ● Sold to customers,...
- 10
- 295
- 0
THE BALANCE SHEET POCKET BOOK phần 4 pps
... year the meter is set to zero and the profits are measured as they are re-cycled 33 NOTES 34 CLASSIFICATION OF EXPENDITURE CAPITAL or REVENUE? Page Why Classify? 36 Classification of Expenditure ... capital expenditure, the second two are revenue 37 CLASSIFICATION OF EXPENDITURE WHAT WILL IT DO TO MY PROFIT? EXPENDITURE AL T PI CA REVENUE FIXED ASSETS Depreciation Raw Materials Wages & Salaries ... included in Attributable Cost - and hence reduces profit as soon as the product/service for which it was purchased is sold CLASSIFICATION OF EXPENDITURE CONTROL CAPITAL EXPENDITURE ● Commits Long -Term...
- 11
- 259
- 0
THE BALANCE SHEET POCKET BOOK phần 5 docx
... Depreciation) 48 Working Capital 51 Source of Funds 53 The Balancing Act 56 Summary 59 Published Format 65 45 THE BALANCE SHEET INTRODUCTION SHARE CAPITAL LOAN CAPITAL RETAINED PROFITS SOURCE ... THE BALANCE SHEET FORMAT The Balance Sheet format swops the two halves of the model over: ● ● Use of Funds appears at the top of the statement Source of Funds appears at the bottom of the statement ... 49 THE BALANCE SHEET DEPRECIATION OF FIXED ASSETS Depreciation is not applied to land (with the exception of quarries and mines) It is applied to all other Fixed Assets: 50 THE BALANCE SHEET WORKING...
- 12
- 263
- 0
THE BALANCE SHEET POCKET BOOK phần 6 pptx
... COMMON MISCONCEPTIONS The accountant balances the Balance Sheet by entering a balancing figure somewhere probably profit.’ The Balance Sheet balances automatically because for every transaction ... Retained Profits) 61 THE BALANCE SHEET SUMMARY Here is the same Balance Sheet expanded to itemise the Fixed Assets and the constituent parts of Working Capital: Balance Sheet as at 31st December ... valued at a standard or ‘nominal’ value (see page 54) ● LOAN CAPITAL long-term borrowings from Banks (or similar institutions) ● RETAINED PROFITS the accumulation of profits re-invested into the...
- 12
- 345
- 0
THE BALANCE SHEET POCKET BOOK phần 7 ppt
... THE BALANCE SHEET INTERNAL FORMAT ● The format examined to this point has addressed an internal report to the Management Team ● The focus has been to consider the Management decisions in ... return on the Net Capital Employed ● The Report provides essential management information 65 THE BALANCE SHEET PUBLISHED FORMAT The Balance Sheet published format A Report to the Owners of the ... referenced to the Balance Sheet ● 68 In most companies the Balance Sheet is subject to external audit (Note: different rules now apply for small companies) The format is required to show the comparative...
- 11
- 224
- 0
THE BALANCE SHEET POCKET BOOK phần 8 pdf
... Note - Interest must be paid whether the company has had a good year or not, so the greater the loan capital within the business, the greater the financial risk ● Tax: Whilst businesses aim to ... PROFIT AND LOSS ACCOUNT PROFIT NOT CASH ● Goods received, and not yet used for the products that have been sold will appear as Stock on the Balance Sheet ● Goods received, but not yet paid for ... of Directors and /or leave the company vulnerable to takeover bids p11 So the way Earnings are divided has to be a political decision Substantial shareholders, eg, financial institutions, will...
- 12
- 392
- 0
THE BALANCE SHEET POCKET BOOK phần 9 potx
... (usually 12 months) Creditors: The amount of money the company owes its suppliers (also referred to as Payables) 22 Debtors: The sum owed to the business by its customers (also referred to as ... the format may not look dissimilar to the internal management format Preceding years’ figures are required to be shown Figures shown are totals only - some analysis will be available in the Notes ... PROFIT AND LOSS ACCOUNT COMMON MISCONCEPTIONS If I compare the results of two businesses, the one which has made more profit has done better.’ Not necessarily What matters is not profit but...
- 11
- 351
- 0
THE BALANCE SHEET POCKET BOOK phần 10 pptx
... used MATTER It affects - Profit Product Cost Fixed Asset Values Don’t let the accountant take sole responsibility! 106 About the Authors Anne Hawkins, BA, CIMA is a Management Accountant with a first ... modules within Masters Programmes in the UK and overseas Contact For details of support materials available to help trainers and managers run finance courses in -company, contact the authors at: Tall ... DEPRECIATION 101 APPENDIX TWO CALCULATING DEPRECIATION How accountants decide how much depreciation to charge? Depreciation is Assessed on an annual basis by apportioning the ‘depreciable amount’...
- 13
- 341
- 0
báo cáo khoa học: " The Botrytis cinerea xylanase Xyn11A contributes to virulence with its necrotizing activity, not with its catalytic activity" pdf
... E214QRV (CGGATCCACTGCTTTGGTAACCCTGAACAGCAACAATTTGG); and for the E214S mutation, E214SFW (CCAAATTGTGGCTGTTAGCGGTTACCAAAGCAGTGGTTCCGC) and E214SRV (GCGGAACCACTGCTTTGGTAACCGCTGACAGCCACAATTTGG) The insert ... Xyn1 1A, Nicotiana tabacum cv Havana, and two local varieties, Alcalá and Para so The diameter of infection areas for the two local varieties were about half the value obtained for Havana, and ... fused to a poly-His tag to facilitate purification The mgfp4 gene [38] was then amplified from the nos-GFP cassette [39] with either primer pairs GFP-BAM (5’-GCGGATCCGATGAGTAAAGGAGAAGAAC-3’) and...
- 15
- 261
- 0
The Six Driving Forces That Affect Your Business Plan _ And How to Focus on the Best One for Your Company’s Needs
... block than a company with a disreputable past You are worth more as an honorable company with a good reputation than one noted for sleazy management practices and a terrible reputation in the marketplace ... to some tough questions about how and why organizations behave in certain ways.2 What is attractive about the concept is not the sports metaphors, but the idea that different organizations have ... Plan Another example of a plans-driven organization is the military unit preparing for war The precursor to battle is thorough planning, but even this has limits Every good commander knows that...
- 28
- 825
- 0
Tài liệu The Internal Revenue Service Is Not Adequately Protecting Taxpayer Data on Laptop Computers and Other Portable Electronic Media Devices docx
... Audit Manager Joseph Cooney, Acting Audit Manager Midori Ohno, Lead Auditor Richard Borst, Senior Auditor Louis Lee, Senior Auditor Abraham Millado, Senior Auditor Jackie Nguyen, Senior Auditor ... Niguel, California; Atlanta, Georgia; Cincinnati, Ohio; and Salt Lake City, Utah; the Campuses7 in Fresno, California; Atlanta, Georgia; Covington, Kentucky; and Ogden, Utah; and non-IRS offsite facilities ... methods for backup tapes at non-IRS offsite facilities Impact on the Taxpayer The IRS annually processes more than 220 million tax returns containing personal financial information and personally...
- 42
- 289
- 0
22nd Annual Conference on the Globalisation of Investment Funds pot
... International Bar Association the global voice of the legal profession The International Bar Association (IBA), established in 1947, is the world’s leading organisation of international legal practitioners, ... regulatory and product development It also produces an annual newsletter for its members In addition to its programmes at the annual IBA conferences, the Committee presents an annual conference on ... Concurrent session B: UCITS IV Payment details I enclose a cheque/bank draft made payable to the IBA for the total amount payable I have transferred to the IBA bank account the total amount payable...
- 12
- 715
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... for the Channel Cay area increased the number of available SST measurements by a factor of two over Night data alone Day+ Night data also gave us a more valid basis of comparison with the in situ ... error bars indicates that the error was too small to appear on the graph The asterisk on the abscissa marks the onset of high-temperature anomaly in August 1998 Hard corals include Scleractinia ... fragmentation, its potential for recolonization is low following removal from a large area (Knowlton 1992) Ag tenuifolia, in contrast, possesses life-history characteristics that favor its colonization...
- 13
- 583
- 0
FINANCIAL INEQUALITY IN HIGHER EDUCATION THE ANNUAL REPORT ON THE ECONOMIC STATUS OF THE PROFESSION, 2006-07 pdf
... the motivation and the talent to obtain terminal degrees in their disciplines also have the ability to take highly paid positions in the corporate sector When a professor decides to forsake a ... because they yield significant differences in the amount of resources individual institutions have available to build top-notch educational facilities and offer salaries and benefits that allow ... not- for-profit enterprises providing a benefit for society as a whole— not just for shareholders The table shows a ratio of presidential salary to the average salary for a full professor on that campus The...
- 15
- 407
- 0
SOUTHERN COMPANY AND SUBSIDIARY COMPANIES 2001 ANNUAL REPORT potx
... units into 2014 At Plant Hatch, an on- site dry storage facility became operational in 2000 Sufficient dry storage capacity is believed to be available to continue dry storage operations at Plant ... dividends paid per share of common stock The accompanying notes are an integral part of these statements 33 SOUTHERN COMPANY AND SUBSIDIARY COMPANIES 2001 ANNUAL REPORT CONSOLIDATED BALANCE SHEETS AT ... otherwise made available to satisfy obligations of Southern Company or any of its other subsidiaries 52 SOUTHERN COMPANY AND SUBSIDIARY COMPANIES 2001 ANNUAL REPORT NOTES (CONTINUED) Bank Credit Arrangements...
- 44
- 249
- 0
ANNUAL REPORT ON THE TRANSFERS OF CONTROLLED GOODS IN 2009 docx
... for the harmonization of the national legislation with the international regulations and standards in this area The main change was the fact that, in accordance with the international best practice, ... license or approval; That information in the OCD does not match that in the license or the approval; and That the actual condition of the goods does not match the data indicated in the license or the ... of national capacities for the strategic approach to the international chemical management and a workshop on the establishment of national priorities for the Strategic Approach to International...
- 80
- 347
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25