0

studies of therapeutic strategies for atrial fibrillation based on a biophysical model of the human atria

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Tài liệu Báo cáo khoa học: Metabolic gene switching in the murine female heart parallels enhanced mitochondrial respiratory function in response to oxidative stress pdf

Báo cáo khoa học

... and the percentage recovery of state respiration was calculated as the ratio of oxygen consumption before and after oxygen lack All mitochondrial polarographic studies were normalized to total ... employed a mixture of mm malate and 25 lm palmitoyl-l-carnitine as oxidative substrates State respiration (resting) was measured after addition of oxidative substrates, and state respiration after the ... 3B) Again, these changes were abolished in female db ⁄ db heart mitochondria Together, these data suggest that the greater reliance of female murine cardiac mitochondria on glucose than on fatty...
  • 7
  • 582
  • 0
báo cáo hóa học:

báo cáo hóa học:" Right thoracic curvature in the normal spine" pdf

Hóa học - Dầu khí

... radiographic examinations because of the unnecessary exposure to radiation and the ethical problems The other limitation of the study is the lack of sagittal profile information of the spine It ... interpretation of data, and drafting the manuscript KH, HM, and YM performed part of literature review KM and KK performed part of acquisition of data YI participated in design and coordination and helped ... normal spine Journal of Orthopaedic Surgery and Research 2011 6:4 Authors’ contributions TD has contributed to conception and design of the study, acquisition of data, analysis and interpretation...
  • 5
  • 353
  • 0
báo cáo hóa học:

báo cáo hóa học:" Right thoracic curvature in the normal spine" docx

Hóa học - Dầu khí

... radiographic examinations because of the unnecessary exposure to radiation and the ethical problems The other limitation of the study is the lack of sagittal profile information of the spine It ... interpretation of data, and drafting the manuscript KH, HM, and YM performed part of literature review KM and KK performed part of acquisition of data YI participated in design and coordination and helped ... normal spine Journal of Orthopaedic Surgery and Research 2011 6:4 Authors’ contributions TD has contributed to conception and design of the study, acquisition of data, analysis and interpretation...
  • 5
  • 261
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

Hóa học - Dầu khí

... [8–11] as reported in the literature Note that the variation of the range is caused due to the variability in antenna orientation, clothing, and other on- body RF attenuation characteristics The ... (PD) at the sink node On its way to the sink node, a data packet collects the entire route information in the form of a list of the intermediate node-IDs This allows the extraction and analysis of ... with the destination, thus leveraging the link locality in the form of its age Each node is assigned a utility value based on the last encounter time with the destination, and a packet is forwarded...
  • 19
  • 351
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " On the Compensation of Delay in the Discrete Frequency Domain" pot

Báo cáo khoa học

... necessarily the case in applications that require a delay to be applied to the signal The ability to effect delay is important in applications such as channel equalisation, echo cancellation, and the ... capable of effecting a noncausal response, where a delay of − samples is as readily approximated as a delay of samples, the optimum choice is λ = n0 = ( max + )/2 The example channel has and max ... domain SNR Figure 7: Reconstruction SNR for filterbank FDAF equalisation of constant delay Figure 8: Reconstruction SNR for filterbank FDAF equalisation of the linear delay channel The solid trace...
  • 11
  • 309
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Báo cáo khoa học

... USA) was then used to measure the crosssectional area of each traced alveolus The degree of alveolar stability – the change in alveolar size during tidal ventilation Available online http://ccforum.com/content/11/3/R64 ... Critical Care Vol 11 No Pavone et al noncompliant due to the accumulation of pulmonary edema and deactivation of surfactant The pressures required to inflate the injured lung areas are consequently ... Individual alveoli were outlined and the area at peak inspiration (I) and end expiration (E) was measured using image analysis software Alveolar stability was assessed by the percentage change in the...
  • 9
  • 277
  • 0
Báo cáo y học:

Báo cáo y học: "Morphological characterisation of portal myofibroblasts and hepatic stellate cells in the normal dog liver" pptx

Báo cáo khoa học

... variability regarding time of postmortal sampling and fixation, the age of the paraffin blocks, and age, sex and breed variation of the animals However, the used material reflects similar variability ... expression profiles All HSC express vimentin (rat), desmin (rat) and actin (man and rat), but alpha-smooth muscle actin (α-SMA) is classically considered as an indicator of activation (man and rat) ... HSC transfer from a quiescent phenotype into an activated or transdifferentiated state characterised by increased proliferation, contractility and migration, as well as loss of vitamin -A containing...
  • 9
  • 284
  • 0
Báo cáo y học:

Báo cáo y học: " Cardiac effects of induction agents in the septic rat heart" potx

Báo cáo khoa học

... in the text, tables and figures are displayed as means ± standard error of the mean Raw data from each functional and metabolic variable were compared by analysis of variance with repeated measures ... significant, Bonferoni tests were used to compare absolute group means for each variable measured at the same concentration and individual drug concentrations (and washout, WASH) against the initial ... human disease by activating proand anti-inflammatory pathways Another limitation of this study is that in addition to cardiac depression, induction agents also induce a systemic vascular dilatation...
  • 8
  • 286
  • 0
Tài liệu IN THE HEART OF AFRICA pptx

Tài liệu IN THE HEART OF AFRICA pptx

Du lịch

... the Arabs Their patterns have never changed, but the water-jar of to-day is of the same form as that carried to the well by the women of thousands of years ago The conversation of the Arabs is ... of the Arabs that a man of any position should ride a baggage-camel Apart from all ideas of etiquette, the motion of the latter animal is quite sufficient warning Of all species of fatigue, the ... of the Atbara We left Goorashee on the following day CHAPTER III The Arabs' exodus-Reception by Abou Sinn-Arabs dressing the hair-Toilet of an Arab woman -The plague of lice-Wives among the Arabs-The...
  • 219
  • 335
  • 0
Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học: Tyrosine-dependent basolateral targeting of human connexin43–eYFP in Madin–Darby canine kidney cells can be disrupted by the oculodentodigital dysplasia mutation L90V ppt

Báo cáo khoa học

... mutagenic forward primers were used: Y28 6A, 5Â-GATCA TGAATTGTTTCTGTCGCCAGTAACCAGCTTGGCCC CAGGAGGAGACATAGGCG-3Â; LSYTRF, 5Â-GCAAG AAGAATTGTTTCTGTCGCCAGTGAACCGGGTATAT GACAAAGGAGACATAGGCGAGAGGGGAGC-3Â The ... cross the monolayer via the paracellular pathway, thus the accumulation of dye on the basolateral side represents paracellular ux Accumulation of the dye was determined by taking 25 lL aliquots ... without affecting the rate of surface degradation, whereas F52dup does not affect either basolateral expression or degradation (Figs and 6) The nding of altered basolateral expression of the L90V...
  • 14
  • 433
  • 0
The French in the Heart of America doc

The French in the Heart of America doc

Khoa học xã hội

... possession of the said place of Ste Mary of the Falls as well as of Lakes Huron and Supérieur, the Island of Caientoton and of all other Countries, rivers, lakes and tributaries, contiguous and adjacent ... years after that memorable day when Le Caron first said mass on the shores of one of the Great Lakes (Champlain being present) before the farthermost shore of the farthest lake is reached by these ... Massachusetts Bay and Plymouth, and the accurate mapping of all that coast now so familiar; there were the arrivals of the ship Jonas once with temporal supplies and again, as the Mayflower of the Jesuits,...
  • 160
  • 497
  • 0
báo cáo hóa học:

báo cáo hóa học: " Measuring health-related quality of life in Hungarian children with heart disease: psychometric properties of the Hungarian version of the Pediatric Quality of Life Inventory™ 4.0 Generic Core Scales and the Cardiac Module" pptx

Hóa học - Dầu khí

... not have sociodemographic information on the non-participants of the comparison group The situational context of questionnaire completion at the clinic or at home also needs consideration The ... sensitivity and responsiveness in longitudinal studies The Hungarian translation of the PedsQL™ may further facilitate international comparisons and analysis of pediatric health care outcomes across countries ... took part in the adaptation process for the PedsQL™ 3.0 Cardiac Module only; the Hungarian Generic Core Scale was already available through the MAPI Research Institute Of 1000 families approached...
  • 12
  • 619
  • 2
Báo cáo sinh học:

Báo cáo sinh học: " Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" doc

Điện - Điện tử

... (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) Dog (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) ... CDV strains localize in the hippocampus of raccoons as we accumulate additional data from future outbreak, and after we conduct animal tests with the viruses we isolated In contrast, CDV targets ... KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant panda (China) Dog 5804 (Germany) (20) Dog 5804 (Germany)...
  • 14
  • 346
  • 0
báo cáo hóa học:

báo cáo hóa học:" Genetically distant American Canine distemper virus lineages have recently caused epizootics with somewhat different characteristics in raccoons living around a large suburban zoo in the USA" pot

Hóa học - Dầu khí

... (Colorado, USA) (11) Dog (Colorado, USA) Javelina (12) Javelina Raccoon dog T dog Tanu (13) Raccoon anu (Japan) (Japan) Dog (T aiwan) (14) Dog (Taiwan) Dog Hamam (Japan) (15) Dog Hamam (Japan) ... CDV strains localize in the hippocampus of raccoons as we accumulate additional data from future outbreak, and after we conduct animal tests with the viruses we isolated In contrast, CDV targets ... KDK1 (Japan) (16) Dog KDK1 Dog Ueno (Japan) (17) Dog Ueno (Japan) Dog Yanaka (Japan) (18) Dog Yanaka (Japan) Giant panda (China) (19) Giant panda (China) Dog 5804 (Germany) (20) Dog 5804 (Germany)...
  • 14
  • 397
  • 0
báo cáo hóa học:

báo cáo hóa học:" Structural ambiguity of the Chinese version of the hospital anxiety and depression scale in patients with coronary heart disease" doc

Hóa học - Dầu khí

... Anxiety and Depression Scale Acta Psychiatr Scand 1991, 83:81-85 Malasi TH, Mirza IA, el Islam MF: Validation of the Hospital Anxiety and Depression Scale in Arab patients Acta Psychiatr Scand 1991, ... bi-dimensional model of the HADS [17,18,26] Large sample sizes are generally desirable in confirmatory factor analysis and the conservative sample size of the current study may have contributed to the ... that may account for the ambiguous factorial conclusions in the current investigation concerns the issue of translation Translating English language instruments to Chinese language versions can...
  • 5
  • 392
  • 0
báo cáo hóa học:

báo cáo hóa học:" Comparison of the SF-6D and the EQ-5D in patients with coronary heart disease" pdf

Hóa học - Dầu khí

... areas of health have somewhat equal contributions to the total score This is the case for the domains pain and mood/mental health However, the content and weights of the other domains show considerable ... relationships with out of SF-6Ddomains Only mood and mental health behave as expected, as they have a strong relationship with each other and lower correlations with all other domains The EQ-5D and SF-6D ... Statistical analysis A qualitative assessment was carried out by comparing (dis-)similarities among domains [17] and their relative contribution to the utility scores Relative contribution was...
  • 9
  • 408
  • 0
báo cáo hóa học:

báo cáo hóa học:" Mapping of the EQ-5D index from clinical outcome measures and demographic variables in patients with coronary heart disease" pptx

Hóa học - Dầu khí

... paper [14] The dataset was then divided in two by taking a random sample of 60% of the data and separating that data from the remaining 40% to provide an estimation dataset and a validation dataset, ... categorical variables in estimation and validation datasets Variable Estimation dataset, n (%) Validation dataset, n (%) Mean (SD) EQ-5D (estimation dataset) Gender Male Female p-value (estimation dataset) ... models was constructed using the estimation dataset with a combination of these variables depending upon their importance based on adjusted R2 values The variable that gave the largest increase...
  • 13
  • 334
  • 0
Báo cáo toán học:

Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Toán học

... the ASCLT for self-normalized partial sums of random variables in the domain of attraction of the normal law, we will show that the ASCLT holds under a fairly general growth condition on dk = k−1 ... domain of attraction of the normal law, if there exist constants an > 0, bn ∈ R such that S n − bn d −→ N, an where N is the standard normal random variable We say that {Xn }n∈N satisfies the ... in the domain of attraction of the normal law Therefore, the class of random variables in Theorems 1.1 is of very broad range Remark 1.5 Essentially, the open problem should be whether Theorem...
  • 13
  • 480
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Some nonlinear delay integral inequalities on time scales arising in the theory of dynamics equations" ppt

Hóa học - Dầu khí

... Feng et al Journal of Inequalities and Applications 2011, 2011:29 http://www.journalofinequalitiesandapplications.com/content/2011/1/29 Page of 14 A time scale is an arbitrary nonempty closed ... submultiplicative, that is, for a ≥ 0, b ≥ we always have ω (a + b) ≤ ω (a) + ω (b) and ω(ab) ≤ ω (a) ω(b) τ, a, j are the same as in Theorem 2.1 If u(t) satisfies the inequality (1) with the initial condition (2), ... Foundation of Shandong Province (ZR2009AM011, ZR2010AQ026, and ZR2010AZ003) (China) and Specialized Research Fund for the Doctoral Program of Higher Education (20103705 110003)(China) The authors...
  • 14
  • 418
  • 0
Emergency Duties and Deaths from Heart Disease among Firefighters in the United States docx

Emergency Duties and Deaths from Heart Disease among Firefighters in the United States docx

Sức khỏe giới tính

... goodness -of- fit test, we assessed whether the distribution of actual deaths associated with each duty was the same as that of expected deaths, based on the estimates of the average time dedicated ... surveys of 17 large metropolitan fire departments conducted by the International Association of Fire Fighters (2005) (Moore-Merrell L.: personal communication) National data are from annual national ... metropolitan fire departments conducted by the International Associ­ ation of Fire Fighters (2005) (Moore-Merrell L: personal communication) National data are from annual national surveys conducted...
  • 10
  • 327
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25