core competence of the corp C k prahalad g hamel

... Business 12 Core Product Core Product Competence Competence Competence Competence The corporation, like a tree, grows from its roots Core products are nourished by competencies and engender business ... systems Commercial aircraft ternal development of new Marine Plastic process Military aircraft competencies Vickers has V ick ers M a p of Competencies page 12 of 15 The Core Competence of the Corporation ... strategic intent to exploit the convergence of computing and communications, what it called ‘ C& C.’’ Success, top management reckoned, would hinge on acquiring competencies, particularly in semiconductors...

The core competence of the corporation

... most of their cash under their mattresses The benefits of competencies, like the benefits of the money supply, depend on the velocity of their circulation as well as on the size of the stock the ... Concepts of the Corporation: SBU or Core Competence. ’’ Two Concepts of the Corporation: SBU or Core Competence Obviously, diversified corporations have a portfolio of products and a portfolio of businesses ... components They are core products that contribute to the competitiveness of a wide range of end products They are the physical embodiments of core competencies How Not to Think of Competence...

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-speciﬁc manner ppt

... G A G A A A A A AT T TA A G AT C T AT T T G A A C T A G A C C A AT G C T G G G A G A A A A A AT T TA A G AT C T Mut A AT T T G A A C T G T G A A G AT G C T G G G A G A A A A A AT T TA A G AT ... together, these data establish LIN54 as an essential member of the LINC ⁄ DREAM complex delayed entry into mitosis [9] To address whether this is an isolated function of LIN9 or whether it is ... integral and essential subunit of this complex To analyze the function of LIN54, we created a set of deletion mutants Using these mutants, we found that a region of LIN54 that is predicted to form an...

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplification of the myc-tagged HCV-1 core ⁄ core+1 sequence ... myc myc myc N6 (CCG414 fi TAA, Pro25 fi stop in core ORF) Deletion of core nts 342–514 ATG core+1 85 with optimal context GCCCCTCTATGG fi CCGCCACCATGG ATG core+1 85 with optimal context GCCCCTCTATGG...

Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt

... there could be a link between EGF-induced reduction in Bid and tBid levels and the ubiquitin ligase activity of Itch In this study, we ﬁrst examined the ability of Itch to interact with Bid and ... proteins Bim and Bak and the C-terminal fragment of Bid The ubiquitin ligases responsible for the ubiquitylation are in most cases not known [44] Here, we have identiﬁed Itch as the ubiquitin ligase ... Azakir et al Itch promotes tBid degradation Fig tBid, the active, apoptotic form of Bid, interacts with the ubiquitin ligase Itch, which leads to its degradation and proteasomedependent degradation...

Tài liệu Báo cáo khoa học: Identiﬁcation of differentially expressed genes of the Paciﬁc oyster Crassostrea gigas exposed to prolonged thermal stress docx

... approach to the study of the response of C gigas to prolonged heat stress We used animals outside the season of reproductive development and spawning in order to measure temperature stress without the ... constitutive isoforms of HSP70 are synthesized in the gills and mantle of C gigas [26] The expression level of the constitutive forms increases after thermal stress, whereas the inducible one is expressed ... synthesized and ⁄ or renatured under these conditions The upregulation of all of these chaperones conﬁrms the severity of the thermal stress under our experimental conditions A number of genes...

Báo cáo khoa học: Structural mobility of the monomeric C-terminal domain of the HIV-1 capsid protein pptx

... Ser146 in the numbering of the intact CA) The CACW40A protein is monomeric, and its structure is similar to that of the subunits in the dimeric, non-mutated CAC, but, in the monomeric form, the segment ... responsible, from a thermodynamic point of view, for the binding of the monomeric species of CAC? We have previously discussed the variation in the free energy of binding as a function of the changes ... dimerization domain of the HIV-1 capsid protein Science 278, 849–853 23 Worthylake DK, Wang H, Yoo S, Sundquist WI & Hill CP (1999) Structures of the HIV-1 capsid protein ˚ dimerization domain at...

Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx

... inuences the catalytic activity, as both its kcat and Km values remain lower than those of activated 1C zymogen The ratio of the (kcat Km )activated value to the (kcat Km)unactivated value provides ... unactivated (d) and activated (s) 1C zymogens assessed by CD (A) Near-UV CD spectra of unactivated and activated 1C zymogens (0.5 mgặmL)1 in NaCl Pi) (B) Thermal denaturation of unactivated and ... activity to activate an RNase A zymogen By comparing the ribonucleolytic activity and RI afnity of unactivated and activated 1C zymogen with those of other RNase A variants, we can estimate the...

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786 2957 84 6 3.91 ± 1.06 3.76 ± 1.61 2 .82 ± 0.92 ... Faussner et al Role of helix and C-termini in bradykinin receptors Fig Schematic representation of the C-terminal B1wt and B2wt sequences and chimera thereof The C-terminal sequences beginning at transmembrane...

Báo cáo khoa học: Antimicrobial activity of histones from hemocytes of the Paciﬁc white shrimp ppt

... present the results of a proteomic investigation of hemocyte antimicrobial peptides of the Paciﬁc white shrimp, L vannamei, and the role of histones as potentially important components of their ... to separate the hemocytes from the plasma After removal of the plasma from the cell pellets, 600 lL of MAS was added to the eppendorf tubes, which were then vortexed gently to wash the cells Cells ... secreted in the skin mucus and then cleaved by cathepsin D [34] to produce the active peptides These data suggest the possibility that the N-terminus of shrimp histone H2A could be an active antimicrobial...

Báo cáo khoa học: b-Secretase cleavage is not required for generation of the intracellular C-terminal domain of the amyloid precursor family of proteins pot

... important signaling role of the ICDs released by the APP family of proteins, but may impact on other functions of this family of proteins Experimental procedures Reagents Unless otherwise specified, chemicals ... gamma-Secretase cleavage and binding to FE65 regulate the nuclear translocation of the intracellular C-terminal domain (ICD) of the APP family of proteins Biochemistry 42, 6664–6673 Cao X & Sudhof TC (2001) ... cells is due to the fact that the epitope for the antibody against rodent Ab is not present in human APP (Table 1), whereas the absence of this band in the APP KO extract confirms the specificity of...

Báo cáo khoa học: Conformational properties of bacterial DnaK and yeast mitochondrial Hsp70 Role of the divergent C-terminal a-helical subdomain pdf

... that the interface between the DnaK ATPase domain and the b-sandwich, whether belonging to DnaK or to mtHsp70, is modiﬁed as a consequence of the substitution of the divergent a-helical subdomain ... structure for DnaK and mtHsp70 [35], and also indicates that sequence exchange at the PBD of DnaK did not modify the overall secondary structure of the chimeras The intrinsic ﬂuorescence of DnaK has ... that in the absence of nucleotide the emission maximum of mtHsp70 is downshifted by 5–6 nm with respect to that of DnaK The twofold reduction of the KSV values estimated for mtHsp70 both in the absence...

Báo cáo khoa học: Response of the Paciﬁc oyster Crassostrea gigas to hypoxia exposure under experimental conditions pot

... al Oyster response to hypoxia exposure A A B B Fig Quantiﬁcation of HSP70 in C gigas exposed to hypoxia The dotted line represents control samples, the full line the experimental samples, and the ... David et al Oyster response to hypoxia exposure Fig Diagram of the different subtractions performed in C gigas with SSH, after 7–10 days of hypoxia exposure and after 24 days of hypoxia exposure, ... characterized the molecular response to hypoxia exposure under experimental conditions of a marine mollusc, the oyster C gigas Using a SSH method, we obtained 616 different partial sequences of cDNA,...

Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx

... asymmetric unit, and the glutamate- binding modes are identical to each other (Fig 2A) The a- carboxyl and a- amino groups of the bound glutamate are at the bottom of the pocket, and are held in this position ... was ampliﬁed by PCR from the plasmid pCY167 (Suzuki H & Yamada C, Unpublished), using forward primer 5¢-CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢-GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ ... structure of CapD in complex with di -a- l -glutamate peptide, a nonhydrolyzable analog of the substrate, is compared with that of the B subtilis GGT glutamate complex, it is apparent that CapD is a member...

Báo cáo khoa học: Expression and characterization of soluble forms of the extracellular domains of the b, c and e subunits of the human muscle acetylcholine receptor pot

... report, we present the expression and characterization of the ECDs of the b, c and e subunits of the human muscle AChR We describe their expression in a soluble, glycosylated form and in satisfactory ... higher expression of the mouse muscle a ECD [21] To test the effect of these additional epitopes ⁄ tags on the yield of the present proteins, we constructed a set of eight human c ECD variants (c, ... immediate use for the detailed study of the speciﬁcities of the antibodies in MG sera 3564 and the development of antigen-speci c therapeutic approaches Experimental procedures Bacterial and yeast...

Xem thêm

Từ khóa: a new core competence of technology based enterprises other equations of the form b k •••• t ••••••••••••••••••••equations of the form b k •••• t dt f ••••equations of the form x k t •••• ••••••••••••••••••••••••••equations of the form b k •••••••••• dt f properties of the function c p corresponding to the modified langmuir fg volmer and bh isotherm equations the influence of resonance stabilization of the reacting c o double bond on the reactivity of the acylating agent you create an image object by using the createimage method of the component c 7 becoming involved with the core activities of the school and university manual whole cell patch clamping of the herg cardiac k channel functional approaches of developmental competence of the oocyte embryo saturation solubility of the drug c k dans s c s c and purication of the rab7c k dans s c gg s c gg rep 1 complex c griffin robert a robinson and douglas k trask 2003 validation of tissue microarrays using p53 immunohistochemical studies of squamous cell carcinoma of the larynx mod pathol 16 12 1181 1188 f y lee c k leow and w y lau 2001 appendicitis in the elderly australian and new zealand journal of surgery volume 70 issue 8 pp 593 596 published online 24 dec 2001 Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui ro Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ