other equations of the form b k •••• t ••••••••••••••••••••

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

... with η the viscosity of the solvent, k Boltzman’s constant, and T the absolute temperature For polydisperse samples a distribution of the hydrodynamic radii can be obtained in this way from the ... between the two interpenetrating networks may be a useful property that can be exploited in product development Objectives The objective of the present investigation was to study the influence of aggregation ... different concentrations of κ-car The solid line indicates the time dependence of the temperature The dashed lines indicate the position of the temperature where the coil helix transition occurs (b) ...

131
271
0

Structure and rheology of mixtures of the protein b lactoglobulin and the polysaccharide k carrageenan

Danh mục: Khoa học tự nhiên

... with η the viscosity of the solvent, k Boltzman’s constant, and T the absolute temperature For polydisperse samples a distribution of the hydrodynamic radii can be obtained in this way from the ... between the two interpenetrating networks may be a useful property that can be exploited in product development Objectives The objective of the present investigation was to study the influence of aggregation ... different concentrations of κ-car The solid line indicates the time dependence of the temperature The dashed lines indicate the position of the temperature where the coil helix transition occurs (b) ...

132
288
0

Báo cáo y học: "Study of the early steps of the Hepatitis B Virus life cycle"

Danh mục: Y học thưởng thức

... inhibited by recombinant HBs but not by the recombinant LHBs The binding of SHBs with human hepatocytes was further supported by the observation from Bruin et al [39] They have found that the particles ... in the nucleus after two days of the post inoculation, this is agreement with the observation from DHBV [69] The result from the kinetic study on the internalization and transportation of HBV by ... demonstrated that the uptake of DHBV by primary duck hepatocyte (PDH) requires endocytosis [66] The deficient mutant preventing the transport of DHBV to endosome has abolished the infection However,...

13
654
1

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Danh mục: Báo cáo khoa học

... signaling pathways The results were quite different between T- pIC treatment and M-pIC treatment First, in T- pIC treatment, the results showed that NS3-4As (the 1B- 1 and HCV-O strains of genotype 1b) could ... not in the PH5CH8 cells transfected with GL2 or TLR4 siRNA (Fig 3B) This result suggests that the activation of IRF-3 by M-pIC treatment is mediated by the TLR3 ⁄ TRIF signaling pathway We obtained ... activated in M-pIC treatment, and to determine if its activation is mediated by the TLR3 but not the TLR4 signaling pathway, we examined whether or not activation of IRF-3 by M-pIC treatment is speciﬁcally...

16
523
0

Tài liệu Báo cáo khoa học: Long-distance interactions between enhancers and promoters The case of the Abd-B domain of the Drosophila bithorax complex pdf

Danh mục: Báo cáo khoa học

... deﬁned by the promoters of the two reporter genes (3¢ to one of them, Fig 4, bottom), the PTS is able to overcome the enhancer blocking effect of the boundary, and restricts the enhancer activity to ... between the Abd -B promoter and the iab regions [13] The unusual properties of the tmr led to the hypothesis that it may be involved in a process that normally targets the iab regions to the Abd -B promoter ... near the promoter [13] Deletion of these sequences together with the promoter appears to free the enhancers from a bond that tethers them to the Abd -B gene in cis, and allows them to regulate the...

7
719
0

Tài liệu Báo cáo Y học: Electrochemical, FT-IR and UV/VIS spectroscopic properties of the caa3 oxidase from T. thermophilus docx

Danh mục: Báo cáo khoa học

... can be seen concomitant with the reduced state at 1515 cm)1 and the mode typical for the deprotonated form at 1498 cm)1, indicating the protonation of a tyrosine residue with the reduction of the ... respectively) The potential at )220 mV can be attributed to the heme a3–CN– signal, this shift reﬂecting the characteristic behavior of cytochrome c oxidases heme a is expected to contribute with two steps, ... of the data presented here, in spite of the fact that bands in the difference spectra are observed in the region where the modes were attributed The vibrational modes of bound cyanide Electrochemically...

9
528
0

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Danh mục: Báo cáo khoa học

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains used in this ... the TRP sequence is positioned very close to the ATP-binding pocket in the adjacent subunit Thus the TRP sequence at the beginning of the C-terminal helix and the RDF sequence at the end of the ... First, the steady-state expression level of each Vps4p mutant protein tested is equivalent to that of wild-type Vps4p Second, each of the mutant proteins tested retained the ability to interact...

23
490
0

Báo cáo khoa học: Functional analysis of the aglycone-binding site of the maize b-glucosidase Zm-p60.1 pot

Danh mục: Báo cáo khoa học

... Findings that cytokinin-O-glucosides are natural substrates for both of the two b- glucosidases, Zm-p60.1 and Bgl4:1, but the architecture of their sites that recognize the aglycone moieties of these ... the enzyme’s relative catalytic efﬁciency, deﬁned as (kcat ⁄ Km)mutant ⁄ (kcat ⁄ Km)WT by 20% compared with the wild-type for both substrates, by increasing kcat By contrast, the F193A, F20 0K ... conferred by the W37 3K mutation indicate a previously unrecognized function of W373 in the determination of the catalytic rate of the enzyme, albeit one that is consistent with the involvement of F193–aglycone–W373...

13
400
0

Báo cáo khoa học: CpG methylation of the CENP-B box reduces human CENP-B binding pptx

Danh mục: Báo cáo khoa học

... preferentially binds to the unmethylated CENP -B box DNA rather than the methylated form Using the complex-reconstitution assay, we tested the binding of CENP -B( 1–129) to the unmethylated and methylated ... CENP -B and the CpG-methylated CENP -B box In eukaryotes, DNA methylation occurs at the C5 atom of cytosine by the action of methyltransferases To evaluate the effect of CpG methylation on the CENP -B DNA ... E) These results indicate that CENP -B preferentially forms a complex with the unmethylated CENP -B box DNA, rather than the methylated CENP -B box DNA Y Tanaka et al The CENP -B binding afﬁnity to...

8
497
0

The fabric of the cosmos b greene

Danh mục: Vật lý

... At first, the bucket starts to spin but the water ins~de remains fairly stationary; the surface of the stationary water stays nice and flat As the bucket picks u p speed, little by little its ... each other out, as the peak tries to make the water go up while the trough tries to drag it down If the height of one wave's peak equals the depth of the other' s trough, there will be perfect cancellation ... bucket expenment in the following may At the beginning of the experiment, the bucket is spinning with respect to absolute space, but the water is stationary v+rith respect to absolute space That's...

289
244
0

Báo cáo khoa học: Direct CIII–HﬂB interaction is responsible for the inhibition of the HﬂB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

Danh mục: Báo cáo khoa học

... Brilliant Blue staining Acknowledgements The authors would like to thank Professor Siddhartha Roy, Indian Institute of Chemical Biology, Kolkata, for the gift of the E coli strain NUT-21 containing ... enabled by the binding of its central helical region to the substrate-entry cleft of H B [22], as pointed out previously [11] This probably makes CIII a general inhibitor for the cytosolic substrates ... the interactions of the DnaK–DnaJ–GrpE machinery and by H B- mediated degradation Interestingly, these latter proteins that promote the degradation of r32 are themselves produced as a result of...

6
453
0

Báo cáo khoa học: Mechanism for transcriptional synergy between interferon regulatory factor (IRF)-3 and IRF-7 in activation of the interferon-b gene promoter docx

Danh mục: Báo cáo khoa học

... coactivators was more important to their ability to synergize with other transcription factors than to activate transcription by themselves Taken together, these data suggest that in the activation of ... 4) These interactions were rather weak but could be important in the context of the IFN -b promoter if the arrangement of the PRDs allows them to occur The importance of these interactions was tested ... elements in the promoter and to the nature of the factors they bind To investigate the effect of promoter context on the transcriptional activity of IRFs, we used undifferentiated P19 cells and two...

11
487
0

Báo cáo khoa học: Interactions of the antimicrobial b-peptide b-17 with phospholipid vesicles differ from membrane interactions of magainins potx

Danh mục: Báo cáo khoa học

... This is not meant to imply that a peptide that promotes negative curvature will cause the formation of nonlamellar structures, but rather that it will facilitate the formation of transient structures ... phospholipid, DPam2PtdEtn, to obtain an indication of the relationship between insertion of the peptide and the stability of the bilayer phase DPam2PtdEtn is a zwitterionic lipid with a bilayer to hexagonal ... negative curvature is related to the lytic action of mastoparan is not well understood, except for the fact that it would tend to destabilize the bilayer phase toward the formation of inverted phase...

9
266
0

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Danh mục: Báo cáo khoa học

... Plant Plant Plant Plant Plant Plant Mammal Bacterium Mold Yeast Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium ... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a-Amylase Barley ... subsite )2 could importantly inuence utilization of the outermost subsite-6 Such long-range interactions in the substrate-mutant enzyme complex between subsite )2 and other parts of the binding...

14
557
0

Báo cáo hóa học: "Quantification of newly produced B and T lymphocytes in untreated chronic lymphocytic leukemia patients" ppt

Danh mục: Hóa học - Dầu khí

... reliable estimate of the amount of newly produced B and T lymphocytes [8,9] Here, we applied the new assay, together with the flow cytometry, to quantify the number of recently produced B and T ... number of KRECs or TRECs (copies/PBMC) is calculated with the following formula: mean of KRECs or TRECs quantity mean of TRAC quantity / (1) The mean quantity of TRAC has to be divided by because ... patients compared to controls This result suggests that one of the reasons of the early IgM decrease could be attributed to the reduced production of new B lymphocytes because if Ig production...

7
559
0

Báo cáo hóa học: " Biosynthesis of Gold Nanoparticles by Foliar Broths: Roles of Biocompounds and Other Attributes of the Extracts" pptx

Danh mục: Hóa học - Dầu khí

... [18] The boxplot is based on robust statistics which are more resistant to the presence of outliers than the classical statistics based on the normal distribution [19] Hence, the data sets of the ... protection agents In this research using foliar broths to manufacture GNPs, the distribution of the total proteins (CP) versus the conversion of Au(III) is depicted by Fig Other than that of the ... anti-oxidant ability with the bioreduction of Au(III) in biosynthesis of GNPs In summary, being parameter targeted, the methodology demonstrated strengthens the pertinence with respect to biocompounds...

9
305
0

Báo cáo toán học: "A Presentation of the Elements of the Quotient Sheaves Ωk /Θk in Variational Sequences" pdf

Danh mục: Báo cáo khoa học

... ≤ k ≤ N , is the sheave of strongly contact k- forms r(c) Let k = d k 1 + k In [3] and [5] the authours proved the softness of r r(c) r(c) the sheaves k , considered the quotient sheaves k ... · + k We denote by pk : k → k the morphism of sheaves deﬁned by pk ρ = ρq , r,q r r+1 r,q for ≤ q ≤ k k = ker pk , ≤ k ≤ n, is the sheave of contact k- forms r,0 r(c) k = ker pk r ,k n , ... simplicity, r r we will solve this problem in the case of r = and r = Then the other cases follow by the same method Notations and Premilinaries Throughout this paper, the following notations will be...

11
314
0

Báo cáo toán học: "A reﬁnement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps

Danh mục: Báo cáo khoa học

... 3, the tree on the left side is of the ﬁrst class while the other belongs to the second class For simplicity of the remaining presentment, we describe the core idea of the above involution in the ... his study The author is also very grateful to the referees for their valuable suggestions and comments This work was supported by the 973 Project, the PCSIRT Project of the Ministry of Education, ... ﬁrst class consists of trees in which there is at least one colored leaf in the lowest two levels (the two levels furthest to the root) and to the left of which all vertices in the same level have...

9
242
0

Báo cáo lâm nghiệp: "Influence of the form of nitrogen nutrition reductase activity in young black locus" doc

Danh mục: Báo cáo khoa học

... with the advent of the N activity, indicates a relationship ase between both enzyme activities The low NR activity (!1 nmol N0 DW!h-!) of -mg2 nodulated plants could be greatly increased by nitrate ... nitrate supplied via the roots This inducible NR activity was consistently ) DW-h- was highest in the younger expanded leaves that showed the highest nitrate content Studies are in progress to ... expanded, the NR activity decreased in the previous leaf and the highest enzyme activity was found again in the new leaf (Fig 2) When the nitrate supply was withdrawn, the enzyme activity recovered its...

4
202
0

Báo cáo y học: " Reconstitution of the adult B cell repertoire after treatment with rituximab" pptx

Danh mục: Báo cáo khoa học

... and the nonquantitative nature of the bulk PCR approach employed by the investigators Furthermore, for most of the study total B cells were studied without differentiating specific B cell subsets ... generated B cells The growing availability of patients treated with B cell depletion should allow investigators to understand the determinants that underlie B cell reconstitution in different autoimmune ... CD27, it is tempting to postulate that upon profound B cell depletion there could be a re-enactment of early B cell ontogeny and that the cells described in the report by Rouzière and coworkers...

2
231
0