Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions

... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak dependence of the ACF with the mass of the ... (2.40) For fittings of cross -correlation amplitudes (in chapters 3—5), the software package Mathematica 5.0 (Wolfram Research Inc., Champaign, IL) was used to model the changes of CCF amplitudes...

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... to study partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of nonlinear equations, we some manipulation ... generating analytic functions, Laurent or z-transforms, numerical schemes, boundary value problems of partial differential equations, problems of quantum mechanics, and problems of population dynamics...

Characterization of diffusion behavior of a novel extra cellular sphingolipid associated peptide probe by fluorescence correlation spectroscopy and imaging total internal reflection fluorescence correlation spectroscopy

... Characterization of Diffusion Behavior of a Novel Extra- cellular Sphingolipid Associated Peptide Probe by Fluorescence Correlation Spectroscopy and Imaging Total Internal Reflection Fluorescence ... cell membrane organization traced by SBD, two new biophysical tool Imaging Total Internal Reflection -Fluorescence Correlation Spectroscopy (ITIR-FCS) and Imaging Total Internal Reflection -Fluorescence ... Thorsten Wohland, and Rachel Kraut Alternate raft pathways cooperate to mediate slow diffusion and efficient uptake of a sphingolipid tracer to degradative vs recycling pathways Journal of Cell Science...

A correlation based method for direction finding of multipath signals in frequency hopping systems

... communication systems In smart antenna systems, the direction of users is an important factor to increase the capacity, and an antenna array is usually used at the base station to estimate and track ... hopping signals, and a new method is proposed to track multipath frequency hopping signals In Chapter 2, several popular methods for DOA estimation are addressed including maximum likelihood methods, ... using DOA, TOA and TDOA The direction parameters are usually estimated with an antenna array which has a certain geometric shape, and the estimation task is performed by exploiting the data collected...

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

... like to have an efﬁcient algorithm for ﬁnding the best possible encoding of any given meet semilattice The encoding can be represented as a collection of sets of integers (representing bit indices ... optimal encoding is the collection of sets whose overall union is smallest subject to the constraint that the collection forms an encoding at all This combinatorial optimization problem is a form of ... intersection of incomparable types to preserve failure To preserve joins, if that property is desired, we add a constraint Si Sj for every pair of types xi xj and one of the form Si ∩ Sj = Sk for every...

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... pattern of TiO2 nanotubes annealed under N2 atmosphere at 500 ◦ C given in Fig shows predominantly anatase TiO2 [9,22,23] DRUV–vis spectra of the as-anodized and annealed titania nanotubes are...

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a sulfurous pollutant on the CaO NPs/ of 1:40 ... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials,...

Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx

... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3'...

báo cáo hóa học:" Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" pot

... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the standard RV2 and OSM QPCR assays While all of the samples ... 5'-CTTGCCAACGATTACATTTCCAGRGAYGARCT-3' 5' CTGGCTAACGACTACATCTCCAGRGAYGARCT-3' 5'-GGCAGTTTCAAGGCTGTGAATTTYTTYGARCG-3' 5'-CCGTAAGAAATGGTGGTCCTGACRAAYTGNGG-3' 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription,...

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... Biomaterials 1995, 16:545-551 doi: 10.1186/1749-799X-5-32 Cite this article as: Jähn et al., A rapid method for the generation of uniform acellular bone explants: a technical note Journal of Orthopaedic...

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(2):133-40 11 Goksan SB: Treatment of congenital clubfoot with ... initiation of the treatment Side of relapsed foot Relapse Treatment offer to deformity correct the deformity Result of the Result at five Treatment year of follow up Bilateral Left Adductus & Varus Ponseti...

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanoparticle-based hybridization ... separation and diagnosis, the superparamagnetic nanoparticle has a unique advantage over others Herein, we report a novel detection method of HPV DNA combining the advantages of QDs and manipulability...

Báo cáo hóa học: " Research Article A New General Iterative Method for a Finite Family of Nonexpansive Mappings in Hilbert Spaces Urailuk Singthong1 and Suthep Suantai1, 2" potx

... and Suantai introduced a new mapping, called Kmapping, for finding a common fixed point of a finite family of nonexpansive mappings For a finite family of nonexpansive mappings {Ti }N1 and sequence ... Proceedings of the American Mathematical Society, vol 4, pp 506–510, 1953 S Reich, “Weak convergence theorems for nonexpansive mappings in Banach spaces, ” Journal of Mathematical Analysis and Applications, ... for a finite family of nonexpansive mappings and applications,” Indian Journal of Mathematics, vol 41, no 3, pp 435–453, 1999 W Takahashi and K Shimoji, “Convergence theorems for nonexpansive mappings...

Báo cáo hóa học: " Research Article Convergence of a Mimetic Finite Difference Method for Static Diffusion Equation" doc

... Castillo and R D Grone, A matrix analysis approach to higher-order approximations for divergence and gradients satisfying a global conservation law,” SIAM Journal on Matrix Analysis and Applications, ... ı Libertador, Avenida P´ ez, El Paraiso Coding Postal 1020, Caracas, Venezuela a Email address: mayrafreites@cantv.net J E Castillo: Computational Science Research Center, San Diego State University, ... E Castillo and M Yasuda, A comparison of two matrix operator formulations for mimetic divergence and gradient discretizations,” in Proceedings of the International Conference on Parallel and...

Xem thêm

Từ khóa: graphicalstatistical method for the study of structure and reaction processes of coal a simplified method for the determination of bulldozing resistance a safe and easy gene transfer method for the treatment of spinal cord injury protocol for the use of a rapid real time pcr method for the detection of hiv 1 proviral dna using double stranded primer study of proteins by imaging total internal reflection fluorescence correlation spectroscopy itir fcs a general and simple method for obtaining a simple and general method for transferring genes a simple and general method for semi supervised learning a latent dirichlet allocation method for selectional preferences a new dataset and method for automatically grading esl texts an exact method for the stability analysis of timedelayed linear a simple and general method for transferring genes into plants horsch a simple and general method for transferring genes into plants pdf a simple and general method for transferring genes into plants a simple and general method for semisupervised learning Báo cáo quy trình mua hàng CT CP Công Nghệ NPV Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDE Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ