a simplified method for the determination of bulldozing resistance
a novel method for the synthesis of titania nanotubes using
... nanotubular surfaceand thus increases the rate of formation of the nanotubes. On the other hand, the formation of the nanotubes using conventionalmagnetic stirring is retarded by the formation of a ... ultrasonic-mediated, mag-netically stirred, anodized titanium samples are designated in the main text as UAT and SAT, respectively.2.3. Annealing of the materials The anodized titania nanotubular arrays ... However, the annealed titania nanotubesare crystalline (mostly anatase) and show varied activity de-pending on the material preparation and annealing atmosphere(Fig. 12).Titania nanotubes prepared...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... the nanoparticles by studying the images indicates that the synthesized size nanoparticles are less than 100 nm. That means the synthesized catalysts have nano dimension. Also, the analysis ... Chemical Researchwww.jacr.kiau.ac.ir A Novel Method for the Synthesis of CaO Nanoparticle for the Decomposition of Sulfurous Pollutant Meysam Sadeghi*1 , Mir Hassan Husseini21,2Department ... analysis For the evaluation of the reaction of 2-CEPS as a sulfurous pollutant on the CaO NPs/Polyvinyl pyrrolidone (PVP) surface at ambient temperature GC analysis was selected. The effects of the...
- 12
- 705
- 0
Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s fluorescent probe for the determination of glutathione doc
... from the standard curve and the regression equation. The average recovery test was made using the standardaddition method, and the RSD was generally goodwhen obtained from a series of six plasma ... (II) may lead to a significant fluorescence recovery of the bis(b-CD)s. Therefore, a rapid and simple spectrofluorimetric method wasdeveloped for the determination of glutathione. The analytical application for ... platelets [10]. Afterwards, 0.50 mL of absolute alcohol was added to the plasmawith shaking. Plasma proteins were precipitatedand removed by centrifugation. The final plasmasamples used in the...
- 8
- 429
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... integrated and comprehensive approach towards the promotion of healthy diets and physical activity V.8.1. A coherent and comprehensive approach aimed at making the healthy choices available, affordable ... lack of physical activity are therefore the leading causes of avoidable illness and premature death in Europe. 7. The underlying determinants of the risk factors for the major chronic diseases ... Platform for Action on Diet, Physical Activity and Health IV.1.1. In order to establish a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched...
- 22
- 703
- 0
Tài liệu Đề tài " A shape theorem for the spread of an infection " pdf
... therefore on the movement of all the other particles.In the present case we can take πB= π A , which has the great advantagethat the path of ρ does not depend on the paths of the other particles. ... t) has the same distribution at the space-time point (x + y, t + s)asthefull-space process (started at (0, 0)) at the point (y, s). Again we shall use the same random walk paths π A for all the ... basic inequalities remain valid for k = 1 by trivial modifications which we again leave to the reader. For the various estimates we have to take all tklarge. This will automatically be the case...
- 67
- 490
- 0
Tài liệu OUTLINES OF DAIRY BACTERIOLOGY A CONCISE MANUAL FOR THE USE OF STUDENTS IN DAIRYING docx
... upon arrival at the farm, so that the conditions are favorable for rapid fermentation. Many of the taints that bother factories are directly traceable to such a cause. A few dirty patrons will ... made in an approximate manner so as to serve as a test at the weigh-can or intake. The test is best made by the use of the well known alkaline tablet which is composed of a solid alkali, and ... hydrogen, carbon, oxygen, together with a limited amount of mineral matter. The nitrogen and carbon are most available in the form of organic compounds, such as albuminous material. Carbon in the form...
- 201
- 540
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... have changed dramati-cally in the past years, and as a result, policy with respect tomanaging tobacco usage behavior also has changed. The re-lationship of behavior management and externalities ... act asmanagers wish. If a libertarian were to allow any form of "Carrots, Sticks, and Promises / 29 a good understanding of and accommodate the target'sMOAs and the trade-off of free ... toincrease the health of the population and lower the cost of health carethan can treatment of illness.In this article, a conceptual framework is proposed for the management of public health and...
- 14
- 780
- 0
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
... 1162–1168.13 Nakayama M, Takahashi K, Kitamuro T, YasumotoK, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-hara S (2000) Repression of heme oxygenase-1 byhypoxia in vascular endothelial cells. ... HepG2 and HeLa cellswere cultured for 48 h under normoxia or hypoxia, and then harves-ted. The microsome fraction was prepared and used for the assay of HO activity. The data are means ± SEM of ... the maintenance of intracellular heme levelYongzhao Zhang1, Kazumichi Furuyama1, Kiriko Kaneko1, Yuanying Ding1, Kazuhiro Ogawa2,*,Miki Yoshizawa1, Masaki Kawamura1, Kazuhisa Takeda1,...
- 12
- 621
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... olig-omerization, aggregation and fibrilization that Abforms amyloid plaques. As amyloid plaques are prom-inent in the postmortem AD brain, early research the- ories placed the accumulation of extracellular,insoluble ... ablated [41].Amyloid-bAfter the 4.5 kDa Ab peptide was identified as a major component of the amyloid plaques in AD brain[42,43], global AD research focused on this peptide as a causative agent ... that could beexpected within the brain. The capacity for metals tofacilitate this process may therefore be a critical factorin the Ab mediated pathology of the AD brain. Subse-quent to an...
- 9
- 634
- 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... 5¢-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGATGACGACGACAAGATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3rev-Gulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A- 3¢. The PCR product was ... respectively, as a direct electron acceptor. The animal and plant l-gul-onolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate.Only scarce data are available on the ... horizontal transfer of vitamin C-related genes.In the process of microbial adaptation, horizontal genetransfer is essential for the dissemination and assembly of detoxification pathways that can form...
- 11
- 571
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
... prepare International Standards. Draft International Standards adopted by the technical committees are circulated to the member bodies for voting. Publication as an International Standard requires ... followed and the reasons for deviations from this method in the case of particular products. The harmonization of test methods cannot be immediate, and for certain groups of products International ... (informative) Results of interlaboratory trial An international collaborative test was organized in 2000 by AFSSA Ploufragan in Europe, and BioControl Systems in the USA, in the frame of the...
- 34
- 690
- 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt
... Maruyama S,Takahara M, Miyagishima SY, Mori T, Nishida K,Yagisawa F, Nishida K, Yoshida Y et al. (2004)Genome sequence of the ultrasmall unicellular red algaCyanidioschyzon merolae 10D. Nature ... that Prasinophytes also contain PsbQ. The thylakoid membranes of P. parkeae and E. gracilis didnot react with any antibodies against the red algal andcyanobacterial extrinsic proteins (lanes ... hemec attached. These recombinant proteins were used for pre-paration of the antibodies against red algal PsbQ¢, PsbVand PsbU, cyanobacterial PsbU and green algal PsbQ. The antibodies against...
- 11
- 501
- 0
Review of the Existing Techniques for the Determination of Dry Rubber Content in Natural potx
... observed that the change in capacitance values with ORC for different latexsamples exhibit a good relation. The principle of the capacitance method, constructional details of the capacitive transducer, ... an approximatevalue can be obtained. The hydrometer method is widely used for getting anapproximate value of the ORC. The most accurate method having international recognition is the standard ... calibratedvessel. The specific heat of the latex or crepe is then computed, after allowing for the heat absorbed by the flask. It is necessary before the determination of specific heat of any sample,...
- 32
- 890
- 2
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... numericalmodel on the simulation of the wavetransformation on a natural beach, existingexperimental data on the wave dynamics in the nearshore area obtained by Ting andKirby ... generation is assumed as the sum of those respectively due towavebreakingandhorizontalandverticalshear. The verification of the numericalmodelagainstdataobtainedfromvariousindoorexperimentsreveals ... the numerical model can satisfactorily simulate the wave transformation, including wavebreaking, wave runup on the beach, andturbulence generated by wave breaking andshear. As...
- 11
- 460
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Estimation of Distributional SimilaritiesJun’ichi Kazama Stijn De Saeger Kow KurodaMasaki Murata†Kentaro TorisawaLanguage Infrastructure Group, MASTAR ProjectNational Institute of Information ... similarity measure. As for BCband BC a , the results for the tuned and several other values for αare shown. Figure 1 shows the parameter tuning for BCbwith MAP as the y-axis (results for BC a are ... pro-files are multinomial distributions, the pri-ors are Dirichlet, and the base measure is the Bhattacharyya coefficient, we can de-rive an analytical form that allows efficientcalculation. For the...
- 10
- 472
- 0
- a framework for the evaluation of text
- a unified statistical model for the identification of english basenp
- a modern method for guitar school of tarrega volume 1 pdf
- graphicalstatistical method for the study of structure and reaction processes of coal
- a new approach for the morphological segmentation of highresolution satellite imagery
- an exact method for the stability analysis of timedelayed linear
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25