0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

The effects of ZDDP and ashless antiwear additives on the friction and wear characteristics of tribological coatings on steel

The effects of ZDDP and ashless antiwear additives on the friction and wear characteristics of tribological coatings on steel

The effects of ZDDP and ashless antiwear additives on the friction and wear characteristics of tribological coatings on steel

... THE EFFECTS OF ZDDP AND ASHLESS ANTIWEAR ADDITIVES ON THE FRICTION AND WEAR CHARACTERISTICS OF TRIBOLOGICAL COATINGS ON STEEL EDWARD NG SOO YONG (B Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE ... coatings, and antiwear additives i.e ZDDP and TPPT The discussion also includes the impact of these lubricant additives produced on the friction and wear properties of the coatings and attempts ... 4.2.4 Wear protection Mechanism 80 4.3 Conclusions .84 Chapter Effects of Primary ZDDP and Ashless TPPT as Antiwear Additives on the Friction and Wear Behaviour of Cr-N Coatings...
  • 201
  • 496
  • 0
The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

The effects of clay a m e n d m e n t and composting on metal speciation in digested sludge liang qiao

... total metal concentration increased due to the organic decomposition and therefore reduction of sludge mass The variation of DTPA extracted metals seems to be related to the changes in metal speciation ... affected by the addition of red mud Since the heavy metals have different properties and different concentrations in the red mud and compost mixtures, the speciation of metals and the effect of ... the concentration of total metal in compost as the reference for the metal distribution in the compost, three different kinds of independent measurement were carried out They are the direct measurement...
  • 14
  • 1,026
  • 0
Music cover, the effects of it and The attitudes of NEU’s students to Music cover in Vietnam

Music cover, the effects of it and The attitudes of NEU’s students to Music cover in Vietnam

... points which are mentioned: (1) The real definition of music cover and NEU’s students knowledge about the definition (2) The influence of music covers on Vietnamese music; (3) The thoughts of ... What’s music cover and how NEU’s students define it? How does music cover influence Vietnamese music? What NEU’s students think about music cover in Vietnam? Methodology: To research the topic, ... perfect entity to take the research The study illustrates the effects of music cover and NEU students behaviors towards the spread of the music cover trend at the moment In the paper, there are...
  • 23
  • 567
  • 0
A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

... of insulation of an IDI diesel engine The indicated power increased at the adiabatic case 30% and 22.5% in part and full loads respectively Although in the EGR applying case, performance characteristics ... also worked as a Professor and Head of department in the Department of Mechanical Engineering, Vidya Vikas Institute of Technology, Andhra Pradesh, India He has 14 years of teaching and research ... [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition engine International...
  • 20
  • 643
  • 0
The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention

The effects of bottom up techniques in teaching listening skills to first year students at the university of fire fighting and prevention

... Investigating the effects of using bottom- up techniques in teaching listening to firstyear students; and - Formulating pedagogical implications and making suggestions for improving the teaching ... 2 The Effects of Bottom- up Techniques in Teaching Listening Skills to First Year Students at the University of Fire Fighting and Prevention Hypothesis This study is designed to test the following ... and learning of the listening skills at UFFP Scope of the study In this study, the investigator intended to use bottom- up techniques to help first year students at UFFP overcome their listening...
  • 46
  • 1,172
  • 4
The relative effects of merit pay, bonuses, and long term incenti on future job performance

The relative effects of merit pay, bonuses, and long term incenti on future job performance

... merit pay, bonuses, and long- term incentives THE RELATIVE EFFECTS OF MERIT PAY, BONUSES, AND LONG- TERM INCENTIVES ON FUTURE JOB PERFORMANCE The logic behind pay-for -performance compensation is that ... Because of the restrictions on long- term incentives, Hypothesis predicted that the effect of bonuses would be stronger than the effect of long- term incentives The results support this 19 hypothesis ... THE RELATIVE EFFECTS OF MERIT PAY, BONUSES, AND LONG- TERM INCENTIVES ON FUTURE JOB PERFORMANCE SANGHEE PARK AND MICHAEL C STURMAN Cornell University School of Hotel Administration G-80-P...
  • 35
  • 517
  • 0
An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability

An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability

... as a model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model ... languages department An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school students attitude and writing ability (Điều tra ... vocabulary and organization Actual writing task analyzing the model Actual writing task Table 2: The steps of a writing lesson of the experimental group and control group The third stage is administering...
  • 60
  • 717
  • 0
Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx

Tài liệu The Economic and Social Effects of Financial Liberalization: A Primer for Developing Countries pptx

... trúc tài quan điểm Thông tin bất cân xứng cấu trúc tài Khung hoảng tài Khủng hoang tai 4/1/2009 Copyright © 2000 Addison Wesley Longman Slide #14-2 1.Cau trúc tai Cấu truc tài 2.Các quan điểm l a ... â xac đò h thơi gian Kiểm soát quản lý Slide #14-6 Các quan điểm l a chọn cấu trúc tài Một công ty tài trợ cho dự án mơi theo cac cach: cách: 1.Vay nợ 2.Huy Huy động cổ phần tư tài trơ co phan ... Nươc Nước ngoai Các tổ chức trung gian tài Người vay tiền Hộ gia đình Doanh nghiệp Chính phủ Nươc ngoai Nước Thò trương trườøng tài 4/1/2009 Copyright © 2000 Addison Wesley Longman Tài trực tiếp...
  • 31
  • 463
  • 0
Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf

Tài liệu NTP-CERHR Monograph on the Potential Human Reproductive and Developmental Effects of Di-Isodecyl Phthalate (DIDP) pdf

... addressing the reproductive and/ or developmental toxicities of these chemicals, and (d) they are of concern to the public The NTP has prepared an NTP-CERHR monograph for each phthalate This monograph ... doses of 0.1, 11, and 1,000 mg/kg, and the percentage of the oxidative derivative of the monoester and of MIDP at the same doses were, respectively, 25 and 30%, 14 and 26%, and 13 and 13% The data ... for either lowering or raising the levels of concern expressed in the conclusions NTP Brief reproductive or developmental effects Thus, the NTP offers the following conclusions Appendix I NTP-CERHR...
  • 147
  • 858
  • 0
Tài liệu The Effects of Education and Health on Wages and Productivity ppt

Tài liệu The Effects of Education and Health on Wages and Productivity ppt

... indication of the effects of education and health on labour productivity In the case of education, it is likely that on average across the community, the effect of a person’s level of education on their ... to the effects of education (section 2.1) and health (section 2.2) on wages 2.1 Education and wages The influence of education on wages has been investigated extensively Often this has been done ... estimates of the effects of education on wages 2.2 Measuring the effects of health status for labour market research 2.3 Overseas estimates of the effects of health on wages 4.1 Estimating the effects...
  • 96
  • 931
  • 0
Tài liệu MIT Joint Program on the Science and Policy of Global Change: Effects of Air Pollution Control on Climate pdf

Tài liệu MIT Joint Program on the Science and Policy of Global Change: Effects of Air Pollution Control on Climate pdf

... to consider carefully the connections between the chemistry of the atmosphere and climate These connections are complex and their nonlinearity is exemplified by the fact that concentrations of ... consideration of control policies applied to local air pollution and global climate It also provides the capability to assess the effects of air pollution on ecosystems, and to predict levels of irritants ... reduce the warming induced by the capping of SOx Note that these climate calculations in Figure omit the cooling effects of the CO2 reductions caused by the lessening of the inhibition of the land...
  • 19
  • 611
  • 1
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx

Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx

... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materially improved after laying aside tobacco; and ... opinion of one of the ablest physicians in Massachusetts, as to the use of tobacco "The chewing of tobacco, " says he, "is not necessary or useful in any case that I know of: and I have abundant...
  • 29
  • 586
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
  • 15
  • 635
  • 0

Xem thêm

Từ khóa: the effects of air pollution on man and environmentdescribe the effects of air pollutants on the environment and human healtheffects of environmental pollution on the respiratory and integumentary systemsthe effects of noise pollution on living things and environmenteffects of noise pollution on humans and the environmentwhat are the damaging effects of ozone depletion on animals and plantsbenefits beyond boundaries the fishery effects of marine reserves and fishery closurescauses and effects of the war of austrian successiondefine inflation and discuss the effects of inflation on international businesscauses and effects of the war of spanish successiondescribe the causes and effects of ozone depletioncauses and effects of the ozone hole over australiaeffects of the interaction between genotype and environmentthe effects of electronic communication and interactionoutlining the effects of pollution on the health environment and economy of a cityNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP