bumper colour and activity

ABC colour and write

...

50
1,352
71

Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modiﬁcations and activity-based analyses doc

... FSBA COFRADIC. The structures of ATP and its reactive homolog FSBA areshown in (A) and (B), respectively. TheCOFRADIC reaction sorting for SBA-labeledpeptides is shown in (C).COFRADIC and protein ... processing [34,36] and N-glycosylation[39] – and describe the use of COFRADIC for study-ing interactions between small molecules and proteins.The latter is a particular application of ‘post-transla-tional ... theavailability of massive numbers of DNA sequences,recent developments in MS, and bioinformatics toolsthat link DNA and protein sequences to informationgenerated by different types of mass spectrometers[16–18].Recently,...

Tài liệu Báo cáo khoa học: Structural insights into the substrate speciﬁcity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt

... and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria Raka Ghosh, Sibani Chakraborty, Chandana Chakrabarti, Jiban Kanti Dattagupta and Sampa ... Chakraborty S, Biswas S, Chakrabarti C &Dattagupta JK (2005) Crystallization and preliminaryX-ray diffraction studies of the cysteine protease erva-tamin A from Ervatamia coronaria. Acta ... S, Sundd M, Jagan-nadham MV & Dattagupta JK (1999) Crystallization and preliminary X-ray analysis of ervatamin B and C,two thiol proteases from Ervatamia coronaria. ActaCrystallogr D 55,...

Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx

... Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor Patrizia Agretti1, ... described as a cause of congenital hypothyroidism. Theeﬀects of combining activating and inactivating mutationswithin a single receptor was studied. The double mutantT477I/P639S contained an activating ... S Maugeri IRCCS, Pavia, Italy Activating mutations of the thyroid-stimulating hormone receptor (TSHr) have been identiﬁed as a cause of toxicadenomas. Germline -inactivating TSHr mutations havebeen...

Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx

... 2007 The Authors Journal compilation ê 2007 FEBS 5065 The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a -amylase participates in substrate binding and activity Sophie Bozonnet1,2, ... a certain distance from the active site. In the crystal structure of barley a-amylase 1, oligosaccharide is thus bound to the sugar tongs’ site. This site on the non-catalytic domain C in the ... furthermore indicateda role in multivalent binding during polysaccharideprocessing.ResultsChoice and production of AMY1 sugar tongs’ mutantsTyr380 in the sugar tongs’ site on domain C of AMY1...

2009 Investment Company Fact Book 49th edition - A Review of Trends and Activity in the Investment Company Industry pptx

... services of ﬁ nancial advisers.LOAD SHARE CLASSESLoad share classes—front-end-load, back-end-load, and level-load shares—usually include a sales load and/ or a 12b-1 fee. The sales load and 12b-1 ... for the ﬁ rst time in the past 16 years. 2009 Investment Company Fact Book 49th edition A Review of Trends and Activity in the Investment Company Industry www.icifactbook.org 2009 INVESTMENT ... to track the performance of the portfolio as a whole. In the case of an index-based ETF, the creation basket is either a replicate or a sample of the ETF’s portfolio. Actively managed ETFs and...

2011 Investment Company Fact Book - A Review of Trends and Activity in the Investment Company Industry doc

... retirement and education savings markets.2010 Research Publications and Statistical ReleasesICI is the primary source of analysis and statistical information on the investment company industry. In ... development: the aging of the U.S. population, the reduced appetite for investment risk by investors of all ages, and the increasing use of target date and other asset allocation funds, many of which are ... closed-end funds, exchange-traded funds, and unit investment trusts. In addition to the annual Investment Company Fact Book, ICI published 20 research and policy reports in 2010, examining the industry, ...

252
1,965
0

Báo cáo khoa học: N-terminal deletion of the c subunit affects the stabilization and activity of chloroplast ATP synthase doc

... 8RIGSVKNTQKITEAMKLVAAAK-31 GGCCATATGCGGATCGGATCAGTCAAA ATTCCGGACpET11-cDN12 12VKNTQKITEAMKLVAAAK-31 TCGGCCATATGGTCAAAAACACGCAGAAG ACGGATCCApET11-cDN16 …16QKITEAMKLVAAAK-31 TTGGCCATATGCAGAAGATCACCGAAGCA ATTAATCTCpET11-cDN20 ... Listed below are the amino-acid sequences and PCR primers of truncationmutants (D)ofthec subunit of spinach chloroplast ATP synthase. The numbers in the plasmids indicate the numbers of residues ... ﬁlament, whichwas attached to the c subunit of the thermophilic bac-terial F1subcomplex, a3b3 c [9], e subunit F1[10,11] and CF1[12]. The catalytic core of the enzyme is a3b3 c, despite...

Asthma Coloring and Activity Book pdf

... people who are dying from asthma is going up.ã Asthma is expensive for the United States. Missed work and school dueto asthma, asthma medicines and hospital visits for asthma cost$6,000,000,000. ... kitchen and eat only at the table.ã Cover cracks and crevices with steel wool, caulk and caulk gum.ã Use roach motels or gel bait. (Dont use sprays.) 5Airways in asthma People with asthma ... the letters of Asthma with different patterns and colors.AAsstthhmmaa POLLUTION things in the air like smoke and dirtthat can bother your airways and cause you to have an asthma attackPREDICT...

Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc

... 1. The structure and conservation of Rio1. (A) The structure of APO -Rio1 showing the important kinase domain features and the Rio1- specific loops (yellow). The P-loop, metal-binding loop and ... metal-binding, and flexible loops.(C) The alignment of the four molecules in the asymmetric unit of the crystals of Rio1- ATP-Mn.N. LaRonde-LeBlanc et al. Structure and activity of the Rio1 kinase FEBS ... with the uncomplexed protein. Com-parisons of the structure of Rio1 with the previously determined structure of the Rio2 kinase defined the minimal RIO domain and the distinct fea-tures of the...

Colour and meaning in corporate logos

... 1350-23IX Brand Management Vol. 16, 8, 545–555 555 COLOUR AND MEANING IN CORPORATE LOGOS ( 4 ) Henderson , P . and Cote , J . ( 1998 ) ‘ Guidelines for selecting or modifying logos ’ , Journal ... 1350-23IX Brand Management Vol. 16, 8, 545–555 549 COLOUR AND MEANING IN CORPORATE LOGOS and temporary housing to disaster relief victims. They want to be seen as being protective, homely and stable. ... recognition and recall. 4,13 Colour may play a role in imparting information, creating lasting identity and suggesting imagery and symbolic value. 4,13 Dowling 8 notes that colour is...

Báo cáo y học: "Alteration of serotonin transporter density and activity in fibromyalgia" pptx

... SERT density and ligand binding affinity, respectively,whereas Vmax and Km values of [3H ]Serotonin uptake weretaken as estimates of SERT rate and affinity, respectively. Avery interesting ... Nemeroff CB: Role of the serotonin in the patho-physiology of depression: focus on the serotonin transporter. Clin Chem 1994, 40:288-295.42. Gursoy S: Absence of association of the serotonin transporter gene ... Internal Medicine, Division of Rheumatology, University of Pisa, Via Roma 67 - 56126 PISA Italy2Department of Psychiatry, Neurobiology, Pharmacology and Biotechnology, University of Pisa, Via...

Báo cáo y học: "Gene expression and activity of cartilage degrading glycosidases in human rheumatoid arthritis and osteoarthritis synovial fibroblast" potx

... MMPs,proinflammatory cytokines and chemokines [13].There is increasing evidence that SFs are key players in thepathogenesis of RA by invading and eroding hyaline cartilage. SFs, activated locally, ... expression in both rheumatoid arthritis and osteoarthritis derived synovial fibroblasts. In addition, expression of cartilage- degrading glycosidases was moderately downregulated byproinflammatory cytokines ... activities of synovial fibroblast samples of rheumatoid arthritis and osteoarthritis patients after TGF-β1 treatmentEnzyme activities of synovial fibroblast samples of rheumatoid arthritis and osteoarthritis...

Báo cáo sinh học: " Chromosomal localization and activity of nucleolar organizer regions in the dog" pot

... of the canine genomepossible. The objective of the present study was the chromosomal localization of NORs in the dog karyotype and the analysis of their activity. This ... were localized in the terminal part of the q arms of chromosome pairs: 7 and 17. The third chromosomepair, also bearing NORs in the terminal part of the q arm, belongs ... 1. INTRODUCTION In the nucleolar organizer regions (NORs), there are genes for 5.8S, 18S and 28Sribosomal RNA. These regions can be visualized by the silver staining...

bumper colour and activity

...

Xem thêm