Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps
Báo cáo y học: " Human endogenous retrovirus HERV-K(HML-2) encodes a stable signal peptide with biological properties distinct from Rec" pps
... were lyzed and CAT-containing cellextracts were added into microplate wells coated with anti-CAT antibody, followed by addition of a digoxigenin-labeled anti-CAT antibody, and by addition of a ... domain (aa 91–96); -3,-1:position of small uncharged residues. By analogy with motifs previously characterized in Rec, a putative arginine-rich nuclear localization signal (NLS; aa 13–20) and a ... isolate; Visna: Maedi-Visna Virus.NhcPutative cleavage SIGNAL PEPTIDE Betaretrovirus(type B)LentivirusGammaretrovirusBetaretrovirus(type D)AlpharetrovirusDeltaretrovirusSpumavirusRSV1365057MMTV178...
- 20
- 250
- 0
Báo cáo y học: "Human endogenous retrovirus-FRD envelope protein (syncytin 2) expression in normal and trisomy 21-affected placenta" doc
... T21-affected placentas, localization of the labeled syn-cytin 2 differs notably from that in gestational age-matched control placentas. Syncytin 2 is mainly located inthe cytoplasm of cuboidal cytotrophoblastic ... jean-louis.frendo@univ-paris5.fr; Sandra Blaise - s.blaise@afssa.fr; Karen Handschuh - karen.handschuh@univ-paris5.fr; Pascale Gerbaud - pascale.gerbaud@univ-paris5.fr; Vassilis Tsatsaris - vassilis.tsatsaris@cch.ap-hop-paris.fr; ... isolated from normal placenta fuse and differentiate into syncytiotrophoblast. At the same time, syncytin 2transcript levels decreased significantly with syncytiotrophoblast formation. In contrast,...
- 10
- 212
- 0
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... primary cell type, and already macro-phages from n-tg rats are at a level comparable to human MDM. This may, in part, relate to the ability of HIV-1 toexploit a distinct set of nuclear transcription ... DNA samples (5'-primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer:CAG ATA GTC ACT ATA AGG ACG AAC) and selected forfurther matings with n-tg Sprague-Dawley rats. Transgeneexpression ... populationswas analyzed by flow cytometry.NucleofectionActivated primary rat T-cells were transfected with proviralreporter plasmids, or with LTR and Tat plasmids, by nucle-ofection and analyzed...
- 19
- 263
- 0
Báo cáo y học: "Autoantibodies against the replication protein A complex in systemic lupus erythematosus and other autoimmune diseases" pps
... USA).Fisher's exact test was used for analysis of association of anti-RPA with other specificities. A relationship between ELISA with anti-RPA70 versus anti-RPA32 mAb was analyzed bySpearman correlation. ... as a target of autoan-tibodies in SLE more than 20 years ago [2,3]. Later the PCNAwas identified as an auxiliary protein of DNA polymerase deltaANA = antinuclear antibodies; DNA-PK = DNA-dependent ... these autoantibodies [30]. In PM/DM, patients with anti-aminoacyl tRNA synthetase antibodies have antibodiesagainst only one of the synthetases, and other patients haveanti-SRP, anti-PM-Scl, anti-Ku,...
- 10
- 447
- 0
Báo cáo y học: " New onset neuromyelitis optica in a young Nigerian woman with possible antiphospholipid syndrome: a case report" pptx
... Olateju - samolateju@yahoo.com; CM Asaleye - casaleye@yahoo.com; Olufemi A Adesina - femisina@yahoo.com; SA Badmus - akintab@yahoo.com* Corresponding author AbstractIntroduction: Devic's ... nerves and the spinal cord. The syn-drome is characterized by a rapid or sub-acute severebilateral visual loss accompanied by transverse myelitisand paraplegia. It tends to affect adults at an ... Initial fundoscopy wasnormal. She had a spastic quadriparesis with a power ofgrade 4 [Medical Research Council (MRC) grading] andbilateral extensor plantar response and absent abdominalreflexes....
- 4
- 250
- 0
Báo cáo y học: "How can the response to volume expansion in patients with spontaneous respiratory movements be predicted" ppsx
... fluid loading(for arterial hypotension, tachycardia, or oliguria) in a patientequipped with a central venous catheter and an arterial cathe-ter, in whom cardiac output was determined by the ... spontaneousbreathing movements. Exclusion criteria were the following:age less than 18 years, pregnancy, and any significant cardiacarrhythmia. Fourteen patients were treated with vasoactiveagents; ... change in vasoactive treatment was allowed duringthe study period.MethodsArterial pressure was measured with either radial or femoralarterial catheters. Cardiac output was measured with a...
- 7
- 386
- 0
Báo cáo y học: "Comparative transcriptome analysis of embryonic and adult stem cells with extended and limited differentiation capacity" pps
... ACCTGGAAGCCTGTCTCTGAvWF GCCAAAGATCTGGAACAGTGT GATGGAGAGGTTACACATCTCF2 CAGCTATGAGGAGGCCTTTG TCACACCCAGATCCATAGCATat TTAAGTCCAATGCGGACCTC GCTCTGTGAATTCCACGTCAAfp GCCCTACAGACCATGAAACAAG GTGAAACAGACTTCCTGGTCCTTtr ... CCAAGCTCAGCACACAAAAA CCAACCACTCTGGGAACTGTvWF CCCACCGGATGGCTAGGTATT GAGGCGGATCTGTTTGAGGTTAfp ACCTGACAGGGAAGATGGTG GCAGTGGTTGATACCGGAGTAlb CTGGGAGTGTGCAGATATCAGAGT GAGAAGGTCACCAAGTGCTGTAGTTat AACCTCAGCACCAATGTTCC ... CCGACGAGTGTAAATTCAAAGAA GGAAGTGGGTTACCTTCATGGSox2 ACCAGCTCGCAGACCTACAT AGTGGGAGGAAGAGGTAACCASox1 CACAACTCGGAGATCAGCAA TGTAATCCGGGTGTTCCTTCPax6 TCAGACCTCCTCATACTCGTGCA TGTAGGTATCATAACTCCGCCCARatGapdh TGCACCACCAACTGCTTAG...
- 20
- 301
- 0
Báo cáo y học: "An improved method for detecting and delineating genomic regions with altered gene expression in cancer" ppsx
... that this way of calculating the regulariza-tion parameters is reasonable. Finally, we remark thatApplication to synthetic dataFigure 4Application to synthetic data. For illustration, we applied ... Radvanyi F, Barillot E: Analysis ofarray CGH data: from signal ratio to gain and loss of DNAregions. Bioinformatics 2004, 20:3413-3422.39. Myers C, Dunham M, Kung S, Troyanskaya O: Accurate detectionof ... Microarray analysisreveals a major direct role of DNA copy number alterationin the transcriptional program of human breast tumors. ProcNatl Acad Sci USA 2002, 99:12963-12968.7. Reyal F, Stransky...
- 15
- 258
- 0
Báo cáo y học: "Human toxoplasmosis and the role of veterinary clinicians"
... Publisher. All rights reserved Short Communication Human toxoplasmosis and the role of veterinary clinicians Laura Kramer Department of Animal Health- Veterinary Parasitology Laboratory- University ... wear gloves when gardening or working with soil and should immediately wash their hands after-wards. They should also avoid eating unwashed fruits or vegetables from a garden. Finally, because ... animal clini-cians. Veterinarians are often faced with the need to explain to their clients that it is not necessary, for example, to give away one’s cat during pregnancy and that if they follow...
- 2
- 499
- 0
Tài liệu Báo cáo Y học: Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose doc
... 2002YPYDPDYA was i ntroduced to the C-terminus ofDmNST by PCR using 5¢-DmNST (5¢-TAGAATTCTAGCACCATGAATAGC-3¢)and3¢-DmNST-HA (5¢-CCGCGGCCGCTCATGCGTAATCCGGAACGTCGTAGGGGTAGACGCGCGGCAGCAG-3¢) as ... 5¢-GGCATTCTGGAGCACCAGCA-3¢N4 7A: 5¢-GGCAGCCTGGACCACCAGCA-3¢I51T: 5¢-TGCTGAGGGTGAGGGAGGC-3¢Q89E: 5¢-ACCCCTCTTCTCTGCGAAGAGC-3¢Q12 9A: 5¢-GGCAACATACGCGAGGTTATT-3¢L174M: 5¢-GCTGCAGTGGGCCTCCCTGCTGATGCTCTTCACTGG-3¢Primers ... structure of oligosaccharide chains by affectingthe availability of substrates for glycosyltransferases [1].In fact, in organisms such as Drosophila melanogaster andCaenorhabditis elegans, de ®ciencies...
- 11
- 477
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thơ nôm tứ tuyệt trào phúng hồ xuân hươngSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ