Eur J Biochem 269, 128±138 (2002) Ó FEBS 2002 Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDP-galactose Hiroaki Segawa*, Masao Kawakita  and Nobuhiro Ishida Department of Physiological Chemistry, The Tokyo Metropolitan Institute of Medical Science (Rinshoken), Honkomagome, Bunkyo-ku, Tokyo, Japan A putative Drosophila nucleotide sugar transporter was characterized and shown to be the Drosophila homologue of the human UDP-Gal transporter (hUGT) When the Drosophila melanogaster UDP-Gal transporter (DmUGT) was expressed in mammalian cells, the transporter protein was localized in the Golgi membranes and complemented the UDP-Gal transport de®ciency of Lec8 cells but not the CMP-Sia transport de®ciency of Lec2 cells DmUGT and hUGT were expressed in Saccharomyces cerevisiae cells in functionally active forms Using microsomal vesicles isolated from Saccharomyces cerevisiae expressing these transporters, we unexpectedly found that both hUGT and DmUGT could transport UDP-GalNAc as well as UDP-Gal When amino-acid residues that are conserved among human, murine, ®ssion yeast and Drosophila UGTs, but are distinct from corresponding ones conserved among CMP-Sia transporters (CSTs), were substituted by those found in CST, the mutant transporters were still active in transporting UDP-Gal One of these mutants in which Asn47 was substituted by Ala showed aberrant intracellular distribution with concomitant destabilization of the protein product However, this mutation was suppressed by an Ile51 to Thr second-site mutation Both residues were localized within the ®rst transmembrane helix, suggesting that the structure of the helix contributes to the stabilization and substrate recognition of the UGT molecule Oligosaccharide chains of secretory and membrane-bound glycoproteins and glycolipids play important roles in various biological processes Two major groups of proteins, nucleotide sugar transporters (NSTs) and glycosyltransferases, contribute to oligosaccharide synthesis Nucleotide sugar transporters carry speci®c nucleotide sugars that are produced outside the Golgi apparatus and ER into these organelles, where they serve as the substrates for the elongation of carbohydrate chains by appropriate glycosyltransferases Changes in the activities of NSTs may affect the structure of oligosaccharide chains by affecting the availability of substrates for glycosyltransferases [1] In fact, in organisms such as Drosophila melanogaster and Caenorhabditis elegans, de®ciencies in enzymes involved in oligosaccharide biosynthesis and putative nucleotide sugar transporters lead to abnormal development of these organisms [2,3] However, the regulation of glycoconjugate structure through the availability of nucleotide sugar substrates remains unclear, because much less attention has been paid so far to NSTs than to glycosyltransferases and because the molecular detail of NST structures has not been determined until quite recently Several NST genes have been isolated recently from organisms including yeasts [4±7], protozoa [8], worms [9], and mammals [10±16] These genes encode structurally related hydrophobic membrane proteins The UDP-Gal transporter (UGT), UDP-GlcNAc transporter (UGlcNAcT) and CMP-Sia transporter (CST) show considerable similarity with each other, but have distinct substrate speci®cities The mechanisms underlying the speci®c substrate recognition are intriguing, but remain obscure Alignment of new members of the NST family with other family members may offer clues about the mechanisms of substrate recognition by NSTs In this communication, we describe the molecular cloning and characterization of a Drosophila homologue of mammalian NST (DmNST), which we found in the D melanogaster expressed sequence tag (EST) database The deduced amino-acid sequence of DmNST showed moderate similarity to hUGT, hUGlcNAcT and hCST, and heterologous expression in yeast allowed us to identify the Correspondence to M Kawakita, Department of Applied Chemistry, Kogakuin University, 1-24-2 Nishi-Shinjuku, Shinjuku-ku, Tokyo 163-8677, Japan Fax: + 81 3340 0147, Tel.: + 81 3340 2731, E-mail: bt13004@ns.kogakuin.ac.jp Abbreviations: NST, nucleotide sugar transporter; UGT, UDPgalactose transporter; UGlcNAcT, UDP-N-acetylglucosamine transporter; CST, CMP-sialic acid transporter; UDP-Gal, UDP-galactose; UDP-GlcNAc, UDP-N-acetylglucosamine; CMP-Sia, CMP-sialic acid; UDP-GalNAc, UDP-N-acetylgalactosamine; DmNST, Drosophila melanogaster NST; EST, expressed sequence tag; hUGT, human UDP-galactose transporter; hCST, human CMP-sialic acid transporter; hUGlcNAcT, human UDP-N-acetylglucosamine transporter; HA, in¯uenza virus hemagglutinin; FITC, ¯uorescein isothiocyanate; GS-II, Gri€onia simplicifolia lectin II; PNA, peanut agglutinin *Present address: Department of Biochemistry, University of Kentucky Medical Center, College of Medicine, Lexington, KY, USA  Present address: Department of Applied Chemistry, Kogakuin University, Nishi-Shinjuku, Shinjuku-ku, Japan Note: the nucleotide sequence for DmUGT reported in this paper has been submitted to the GenBank/EMBL/DDBJ under accession number AB055493 (Received 31 August 2001, accepted 24 October 2001) Keywords: UDP-galactose transporter; UDP-galactose; UDP-N-acetylgalactosamine; nucleotide sugar transporter; site-directed mutagenesis Ó FEBS 2002 UDP-Gal transporter transports UDP-GlcNAc (Eur J Biochem 269) 129 new NST as the Drosophila homologue of hUGT (DmUGT) Detailed analysis of substrate speci®city revealed that both DmUGT and hUGT were able to transport UDP-GalNAc in addition to UDP-Gal MATERIALS AND METHODS Materials Drosophila melanogaster cDNA clone GH12865 was obtained from the BDGP/HHMI Drosophila EST project through Research Genetics Inc (Huntsville, AL, USA) The radioactive substrates UDP-[6-3H]Gal (60 Ciámmol)1), UDP-[6-3H]GalNAc (10 Ciámmol)1), UDP-[1-3H]Glc (15 Ciámmol)1), UDP-[6±3H(N)]GlcNAc (60 Ciámmol)1), UDP-[1-3H]GlcA (15 Ciámmol)1), UDP-[14C]Xyl (238 mCiámmol)1), CMP-[9-3H]Sia (15 Ciámmol)1), and GDP[2-3H]Man (15 Ciámmol)1), were purchased from American Radiolabeled Chemicals Inc (St Louis, MO, USA) Cells and transfection Lec8 (ATCC CRL1737) and Lec2 (ATCC CRL1736) cells were maintained in minimum essential medium a (MEM-a) (Life Technologies, Gaithersberg, MD, USA) supplemented with 10% fetal bovine serum Transfection of expression plasmids wascarriedoutusingLipofectAMINE reagent(Life Technologies), following the manufacturer's instructions Antibodies A rat monoclonal anti-HA Ig (clone 3F10) was purchased from Roche Diagnostics (Basel, Switzerland) An Alexa594conjugated goat anti-(rat IgG) Ig (Molecular Probes, Eugene, OR, USA) and a horseradish peroxidase (HRP)conjugated goat anti-(rat IgG) Ig (Santa Cruz Biotechnology Inc., Santa Cruz, CA) were used as secondary antibodies in indirect immuno¯uorescence and Western blot analysis, respectively Site-directed mutagenesis and insertion of an hemagglutinin tag We utilized the megaprimer method [17] to obtain aminoacid substitution mutants Mutagenic primers listed in Table were used The ®rst PCR was carried out using an appropriate mutagenic primer and an upstream or a downstream primer The primer sets are listed in Table Each PCR cycle consisted of denaturation at 98 °C for 10 s, annealing at 55 °C for 30 s, and extension at 72 °C for 60 s, and this reaction cycle was repeated 30 times The product of the ®rst PCR was isolated by 1% agarose gel electrophoresis, and then used as the primer (megaprimer) in the second PCR The ®nal PCR product was digested with PstI and EcoRI or NotI, and used to replace the corresponding fragment of pMKIT-neo-hUGT1-cHA An in¯uenza virus hemagglutinin (HA) epitope tag encoding the sequence Table Oligonucleotides used in mutagenesis in this study Bold letters indicate mismatched bases Mutagenic PCR primer set Primers for the ®rst PCR: Upstream primer: NI254 : Downstream primer: one of the following mutagenic primers V45L: N47A: I51T: Q89E: Q129A: L174M: Primers for the second PCR: Upstream primer: mega primers obtained from the ®rst PCR Downstream primer: NI255: 5¢-GTCTTTGTTTCGTTTTCTGTTCTG-3¢ 5¢-GGCATTCTGGAGCACCAGCA-3¢ 5¢-GGCAGCCTGGACCACCAGCA-3¢ 5¢-TGCTGAGGGTGAGGGAGGC-3¢ 5¢-ACCCCTCTTCTCTGCGAAGAGC-3¢ 5¢-GGCAACATACGCGAGGTTATT-3¢ 5¢-GCTGCAGTGGGCCTCCCTGCTGATGCTCTTCACTGG-3¢ 5¢-TGCCAGGCCTGCCCCAGGGTTCTG-3¢ Mutagenic PCR primer set Primers for the ®rst PCR: Upstream primer: one of the following mutagenic primers, I181L: Q185K: F265Y: V286T: Downstream primer: 11±5: Primers for the second PCR: Upstream primer: NI335: Downstream primer: megaprimers obtained from the đrst PCRs 5Â-GGCGTCGCCCTTGTCCAGGCAC-3 5¢-AGGCAAAGCAAGCCGGTGGG-3¢ 5¢-GGTTTCTTTTATGGGTACACACCTGC-3¢ 5¢-CGGCGGGCTACTGACGGCTGTGGTTGTCA-3¢ 5¢-ACCCTTTAAGCCCCGCCCCATTTA-3¢ 5¢-CTGGTTCTCTTCCTCCATGAG-3¢ 130 H Segawa et al (Eur J Biochem 269) YPYDPDYA was introduced to the C-terminus of DmNST by PCR using 5¢-DmNST (5¢-TAGAATTCTA GCACCATGAATAGC-3¢) and 3¢-DmNST-HA (5¢-CCG CGGCCGCTCATGCGTAATCCGGAACGTCGTAG GGGTAGACGCGCGGCAGCAG-3¢) as primers and clone GH2865 as the template Nucleotide sequences of all the constructs were con®rmed before their use in transfection experiments Ó FEBS 2002 Staining with lectin and antibody Nucleotide sequences of both strands of PCR products were determined by the dideoxy chain termination method using a Thermo Sequenase II Dye terminator cycle sequencing kit (Amersham Pharmacia Biotech) with an ABI Prism A377 sequencer (PerkinElmer Applied Biosystems) Lectin staining and indirect immuno¯uorescence staining were carried out as described previously [6] Brie¯y, the cells were ®xed with 3.7% formaldehyde in sodium phosphate buffer, and permeabilized with 0.1% Triton X-100 in phosphate buffered saline Then the cells were stained with ¯uorescein isothiocyanate (FITC)-conjugated Gri€onia simplicifolia lectin II (GSII) or peanut agglutinin (PNA) (EY Laboratories, San Mateo, CA, USA), and further incubated with monoclonal anti-HA Ig to detect the transporter protein expressed in the cells The cells were then incubated with the secondary antibody, Alexa594conjugated anti-(rat IgG) Ig Fluorescence labeling was visualized under a Carl Zeiss laser scanning confocal microscope LSM510 Yeast strains and transformations Western blot analysis To obtain expression of the product of a given cDNA in yeast cells, the copper-inducible expression vector pYEX-BX (Clontech Laboratories, Palo Alto, CA, USA) was utilized The plasmid was digested with EcoRI and then treated with T4 DNA polymerase The blunt-ended plasmid was further digested with BamHI, and then a synthetic oligonucleotide adapter [HS-16 (5¢-GATCCGAATTCC CGGGCGGCCGC-3¢) annealed with HS-17 (5¢-GCGGC CGCCCGGGAATTCG-3¢)] was inserted to ®ll the gap between the BamHI and blunted EcoRI sites A plasmid that had a multicloning site with four restriction sites (BamHI, EcoRI, SmaI and NotI) was generated in this way The modi®ed plasmid, pYEX-BESN, was utilized to construct pYEX-hUGT-cHA and pYEX-DmNST-cHA, in which HA-tagged hUGT1 and HA-tagged DmUGT cDNAs, respectively, were inserted into the EcoRI±NotI site S cerevisiae YPH500 cells (MATa ura3-52 lys2-801 ade2-101 trp1-D63 his3-D200 leu2-D1) were transformed with these expression plasmids by the lithium acetate method [18] Western blot analysis was carried out as described previously [14] Brie¯y, transfected cells were lysed in an extraction buffer [10 mM Tris/Hepes (pH 7.4), 10 mM KCl, mM EDTA, 0.2% Nonidet P-40, mgámL)1 of aprotinin, mgámL)1 of pepstatin A, mgámL)1 of leupeptin, 0.5 mM phenylmethanesulfonyl¯uoride], and the samples were fractionated by electrophoresis on a 12% SDS/polyacrylamide gel The separated polypeptides were electotransferred to a poly(vinylydene di¯uoride) membrane, and the transporter proteins were detected with a monoclonal anti-HA Ig using a Renaissance Western Blot Chemiluminescence Reagent Plus Kit (NEN Life Science Products, Boston, MA) Luminescence was detected using a Kodak IS440CF image analysis system (NEN Life Sciences) DNA sequencing Subcellular fractionation and nucleotide sugar transport assay The subcellular fractionation and transport assay were performed as described previously [19,20] The membrane fractions obtained by centrifugation at 10 000 g and 100 000 g were combined and used in the transport assay Microsomes (50 lg of protein) were incubated in 0.1 mL of TSM buffer [10 mM Tris/HCl (pH 7.0), 0.8 M glucitol, mM MgCl2, 50 mM dimercaptopropanol] containing lM radioactive substrate (6400 Ciámol)1 unless otherwise speci®ed) at 30 °C for the time period indicated in each ®gure legend To determine GDPMan transport, 30 lg of microsomal protein and GDPMan (3200 Ciámol)1) were used The UDP-Xyl transport assay was carried out using UDP-[14C]Xyl with a speci®c radioactivity of 640 Ciámol)1 The reaction was terminated by 10-fold dilution with ice-cold TSM buffer containing 10 lM nonradioactive substrates The radioactive material incorporated into microsomes was trapped on a nitrocellulose ®lter (Millipore, Bedford, MA, USA) and the radioactivity retained on the ®lter was measured RESULTS Cloning and characterization of D melanogaster nucleotide sugar transporter We found a putative nucleotide sugar transporter gene showing considerable similarity to human UGT, UGlcNAcT and CST through a BLAST search of the D melanogaster EST database We tentatively named the gene ÔD melanogaster nucleotide sugar transporterÕ (DmNST) The gene turned out to be the D melanogaster UDP-Gal transporter, and was renamed DmUGT, as described later in this paper The cDNA clone GH12865, from which the pertinent EST sequence was derived, was obtained from the BDGP/ HHMI Drosophila EST project (http://www.fruit¯y.org/ EST), and the nucleotide sequence was determined The nucleotide and deduced amino-acid sequences are shown in Fig 1A When the nucleotide sequence obtained was compared with the genomic DNA data, the DmNST mRNA was revealed to be composed of three exons The exon that coded for the N-terminal portion was different from the one predicted by the GENEFINDER program in 1998 (SPTREMBL accession number O76865), but coincided with the prediction made in 2000 (SPTREMBL accession number: O9W4W6) The cDNA clone contained an ORF encoding 357 amino acids with a calculated molecular mass of 38 635.3 Da The putative product was very hydrophobic and the hydropathy pro®le resembled Ĩ FEBS 2002 UDP-Gal transporter transports UDP-GlcNAc (Eur J Biochem 269) 131 Fig Sequence analysis of the DmNST/DmUGT (A) Nucleotide and deduced amino-acid sequences of DmNST/DmUGT The GenBank/ EMBL/DDBJ accession number of the nucleotide sequence is AB055493 The putative exon junctions were deduced from comparison with genomic DNA data (accession numbers O76865 and O9W4W6) and indicated by the arrowheads The symbol ÔVÕ indicates a potential Nglycosylation site A putative polyadenylation signal is enclosed by a box (B) Hydrophobicity plot of DmNST/DmUGT The plot was calculated with a window size of 10 amino acids using the hydrophobicity values of Kyte & Doolittle [29] 132 H Segawa et al (Eur J Biochem 269) Ó FEBS 2002 Fig Alignment of DmNST/DmUGT and human NST sequences hUGT1, human UDP-Gal transporter (GenBank accession number D84454) [10]; hCST, human CMP-Sia transporter (D87969) [11]; hUGlcNAcT, human UDP-GlcNAc transporter (AB021981) [15] Thick bars, putative transmembrane helices as proposed by Eckhardt et al [27] Asterisks indicate the Ơsubstrate speci®cÕ residues described previously [15] The solid asterisks indicate ƠUGT-speci®cÕ residues conserved in DmUGT Underlining indicates a potential glycosylation site of DmUGT Fig Expression of DmNST/DmUGT in Lec2 and Lec8 cells (A) Lec2 and Lec8 cells were transfected with appropriate plasmids as speci®ed below, and CST and UGT activities of cDNA products were assessed using FITC-labeled lectins as described in Materials and methods a, pMKITneo; b, pMKIT-neo-hCST-cHA; c, pMKIT-neo-DmNST-cHA; d, pMKIT-neo; e, pMKIT-neo-hUGT-cHA; f, pMKIT-neo-DmNST-cHA Bar, 10 lm (B) Western blot analysis of DmNST/DmUGT protein expressed in Lec2 (lanes and 2) and Lec8 (lanes and 4) cells Cell extracts were prepared from cells transfected with appropriate plasmids as speci®ed below, and were subjected to Western blot analysis Lanes and 3, pMKITneo; lanes and 4, pMKIT-neo-DmNST-cHA those of other NSTs (Fig 1B) As shown in Fig 2, comparison of the amino-acid sequence of DmNST with those of human NSTs indicated that DmNST is equally similar to those three transporters DmNST had 74 residues in common with UGT, 69 residues with UglcNAcT, and 40 residues with CST, in addition to 90 residues conserved Ó FEBS 2002 UDP-Gal transporter transports UDP-GlcNAc (Eur J Biochem 269) 133 transport activity DmNST was located in the Golgi region, as was hUGT1 (panels e and f) In Western blot analysis, the DmNST was detected as a broad band with an apparent molecular mass ranging from 30 to 36 kDa (Fig 3B, lanes and 4) The broadening of the bands might be due to N-linked glycosylation at Asn311 (Fig 1A), as this broadening was not observed with human nucleotide sugar transporters (data not shown) that lack the glycosylation motif at the corresponding sites (Fig 2) The DmNST expressed in Lec8 migrated slightly slower than that expressed in Lec2 (Fig 3B, lanes and 4) This may be explained by the fact that expression of DmNST complemented the defect in UDP-Gal transport of Lec8 cells, and that this would lead to the formation of fully processed oligosaccharide chains attached to the protein hUGT and DmUGT both transport UDP-Gal and UDP-GalNAc Fig Expression of DmNST/DmUGT in mammalian and yeast microsomal membranes Microsomes were prepared from Lec8 or yeast cells expressing DmNST/DmUGT, and samples containing 30 lg of protein were subjected to Western blot analysis Lane 1, pMKIT-neotransfected Lec8; lane2, pMKIT-neo-DmNST-cHA-transfected Lec8; lane 3, pYEX-BESN-transformed YPH500; lane 4, pYEX-BESNDmNST-cHA-transformed YPH500 among all these transporters Accordingly, this sequence comparison alone did not give us suf®cient information to infer the substrate speci®city of this fruit ¯y nucleotide sugar transporter, but rather raised a possibility that the fruit ¯y transporter could transport all the three nucleotide sugars To identify the transport substrate of DmNST, a DNA fragment containing the entire coding region was ampli®ed by PCR and inserted into the expression vector pMKIT-neo utilizing the EcoRI and NotI sites An HA tag sequence was added at the 3¢ end of the coding sequence to facilitate the detection of the cDNA product The expression plasmid, pMKIT-neo-DmNST-cHA, was introduced into Lec2 and Lec8 cells CST-de®cient Lec2 cells bind PNA, which recognizes the terminal Gal residues on their defective surface glycoconjugates, while UGT-de®cient Lec8 cells bind GS-II, which recognizes terminal GlcNAc residues [21] If DmNST complements the genetic defects of these cells, the lectins lose af®nity to the cells This enabled us to assess the CMPSia and UDP-Gal transport activities of the cDNA product using FITC-labeled lectins We are also able to examine the expression of the protein products using an anti-HA Ig at the same time in the same specimen Figure 3A shows that DmNST was expressed in both Lec2 and Lec8 cells, but only the genetic defect of the latter, namely UDP-Gal transport de®ciency, was complemented This indicates that DmNST has UDP-Gal transport activity but not CMP-Sia To examine the substrate speci®city of DmUGT more extensively, we utilized a yeast expression system HA-tagged DmUGT cDNA was inserted into the copperinducible yeast expression vector pYEX-BESN and transfected into S cerevisiae YPH500, and a transformant was obtained We prepared the microsomes from the transformant, and analyzed them for the presence of the DmNST protein by Western blot analysis using anti-HA Ig (Fig 4) DmUGT-cHA migrated as a broad band with an apparent molecular mass ranging from 28 to 36 kDa (lane 4) Microsomes were prepared from transformants carrying vectors with and without the DmUGT insert, and investigated for their activity to transport nucleotide sugars (Fig 5) We also examined the substrate speci®city of human UDP-Gal transporter extensively using microsomal membranes obtained from an hUGT1-transformant of S cerevisiae YPH500 As expected from the results shown in Fig 3, UDP-Gal but not CMP-Sia was incorporated into the microsomes expressing DmUGT An unexpected ®nding was that these microsomal vesicles also incorporated UDP-GalNAc ef®ciently Figure clearly shows that hUGT1, which had been considered to be highly speci®c for UDP-Gal, was also able to transport UDP-GalNAc in addition to UDP-Gal DmUGT and hUGT1 did not transport either UDP-glucuronic acid (GlcA) or UDPxylose (Xyl) Furthermore, they did not seem to transport UDP-GlcNAc, UDP-glucose (Glc), or GDP-mannose (Man), although this is not certain due to interference by the endogenous nucleotide sugar transport activity of S cerevisiae microsomal membranes The apparent Km values of DmUGT and hUGT1 were estimated to be 3.5 lM and 2.5 lM for UDP-Gal and 4.1 lM and 2.5 lM for UDPGalNAc, respectively (Fig 6) These results clearly indicate that DmUGT is the hUGT homologue of D melanogaster showing that both transporters have exactly the same speci®city for substrates so far examined (Fig 5) Mutagenesis of hUGT1 cDNA and assessment of expression and NST activities of mutant proteins DmUGT indicated signi®cant similarity to both hCST and hUGlcNAcT comparable with that to hUGT Its substrate speci®city was, however, exactly the same with that of 134 H Segawa et al (Eur J Biochem 269) Ó FEBS 2002 Fig Nucleotide sugar transport activity of DmNST/DmUGT Microsomes were prepared from pYEX-BESN-transformed YPH500, pYEX-BESN-DmNST-cHA-transformed YPH500, and pYEX-hUGT-cHAtransformed YPH500 Microsomal vesicles (50 lg protein/assay, or in GDP-Man transport assay, 30 lg protein/assay) were incubated at 30 °C for 30 s in the presence of various radioactive nucleotide sugars as indicated below the bars indicating the transport activities Uptake of substrates into microsomal vesicles was determined as described in Materials and methods Fig Substrate concentration dependence of UDP-Gal and UDP-GalNAc transport into yeast microsomal membrane vesicles expressing DmNST/DmUGT and hUGT1 Microsomes (50 lg protein per assay) were incubated at 30 °C for with various concentrations of UDP-Gal (A) or UDP-GalNAc (C), and the transport activity was determined as described under Materials and methods The radioactivities trapped by vector control microsomes were subtracted as background values from corresponding experimental values The double reciprocal plot of the data obtained in (A) and (C) and the results of linear regression analyses are shown in (B) and (D), respectively hUGT as far as examined In one of our previous communications we noted that 10 amino-acid residues seemed to be Ơsubstrate speci®cÕ in that they were conserved among transporters with identical substrates, but were different between those speci®c for different substrates [15] As shown in Fig 2, among these 10 residues, only three, one and three residues were shared by DmNST and hUGT, hUGlcNAcT, or hCST, respectively The three remaining residues were not conserved between these transporters To see if these few conserved residues may be critical in discriminating between speci®c substrates, we have chosen the hUGT molecule as the representative of UDP-Gal transporters, and altered the ƠUGT-speci®cÕ residues of hUGT to their corresponding ÔCST-speci®cÕ residues by sitedirected mutagenesis We paid particular attention to N47, L174 and V285, which were shared by DmUGT and hUGT HA-tagged single-site-mutant constructs, hUGT1(V45L)-cHA, hUGT1(N47A)-cHA, hUGT1(I51T)-cHA, hUGT1(Q89E)-cHA, hUGT1(Q129A)-cHA, hUGT1(L174M)-cHA, hUGT1(I181L)-cHA, hUGT1(Q185K)cHA, hUGT1(F265Y)-cHA, hUGT1(V285T)-cHA, and multiple-site-mutant constructs, hUGT1(N5aaCST)-cHA, hUGT1(C5aaCST)-cHA, and hUGT1(10aaCST)-cHA Ó FEBS 2002 UDP-Gal transporter transports UDP-GlcNAc (Eur J Biochem 269) 135 Fig Assessment of CMP-Sia transport and UDP-Gal transport activities of mutant hUGT1s cDNA constructs coding for HA-tagged transporter proteins, including mutant proteins as speci®ed below, were expressed in CST-de®cient Lec2 (panels a±h), or UGT-de®cient Lec8 (panels i±p) cells Lec2 cells were stained with FITC-labeled PNA, and Lec8 cells with FITC-labeled GS-II to assess CST and UGT activities of the transporters and mutants The expression of proteins was detected by immunostaining with anti-HA Ig, which was visualized by using Alexa596-conjugated anti-(rat IgG) Ig (a and i), pMKIT-neo; b and j, pMKIT-neohCST-cHA; (c and k), pMKIT-neo-hUGT1cHA; (d and l), pMKIT-neo-hUGT1(V45L)cHA; e and m, pMKIT-neo-hUGT1(N47A)cHA; (f and n), pMKIT-neohUGT1(L174M)-cHA; (g and o), pMKITneo-hUGT1(V285T)-cHA; (h and p), pMKIT-neo-hUGT1(10aaCST)-cHA Bar, 10 lm were introduced into Lec2 and Lec8 cells The hUGT1 (N5aaCST)-cHA mutant carried V45L, N47A, I51T, Q89E, and Q129A substitutions, and hUGT1(C5aaCST)-cHA carried L174M, I181L, Q185K, F265Y, and V285T substitutions In the hUGT1(10aaCST)-cHA mutant all of the ƠUGT-speci®cÕ residues were replaced by the corresponding ƠCST-speci®cÕ ones [15] The expression and the transport activities of each mutant were assessed by immuno¯uorescence and FITC-labeled lectin binding as in Fig Figure shows that N47A, L174M and V285T mutants retained UDP-Gal transport activity but were unable to transport CMP-Sia Other single substitution mutants as well as three multiple substitution mutants gave essentially the same results as V45L (Figs 7d,l) and hUGT1(10aaCST) (Figs 7h,p), and were active in UDPGal transport, but not in CMP-Sia transport (data not shown) Most of the mutant proteins, except hUGT1 (N47A)-cHA, were localized in the Golgi apparatus as was the wild-type protein The hUGT1(N47A)-cHA mutant protein was not con®ned to the Golgi region, but was distributed more diffusely in the perinuclear region This mutant showed UDP-Gal transport activity, but the frequency of the cells expressing the mutant was low (Figs 7e,m) The amounts of wild-type and mutant UGT proteins expressed in the transfected cells were analyzed by Western blotting Most of the mutant proteins were detected in roughly the same amounts as hUGT1-cHA, but the amount of hUGT1(N47A)-cHA was much lower than the amounts of the others (Fig 8, lane 4), suggesting metabolic instability of the mutant protein It is noted, however, that hUGT1(N5aaCST)-cHA (lane 13) and hUGT1(10aaCST)-cHA (lane 15) were expressed as ef®ciently as wild-type hUGTcHA, although they carry the N47A mutation This implies that the destabilizing effect of the N47A mutation was suppressed by one of the additional mutations introduced into the hUGT1(N5aaCST)-cHA mutant To identify the second mutation responsible for the suppression of the N47A phenotype, we ®rst constructed a three-site mutant, hUGT1(V45L, N47A, I51T)-cHA, and found that the mutant protein was expressed ef®ciently and distributed normally in the cell We then constructed hUGT1(V45L, N47A)-cHA, hUGT1(N47A, I51T)-cHA, and hUGT1 (V45L, I51T)-cHA, and examined the expression levels of these mutant proteins and their intracellular distribution As shown in Fig 9, introduction of the I51T mutation suppressed the N47A mutation and resulted in the normal 136 H Segawa et al (Eur J Biochem 269) Ó FEBS 2002 Fig Western blot analysis of the expression of mutant hUGT1s in Lec2 cells Lec2 cells transfected with an appropriate plasmid as speci®ed below were incubated for 48 h, then lysed and subjected to Western blot analysis Proteins were detected by immunostaining with anti-HA Ig 1, pMKIT-neo; 2, pMKIT-neo-hUGT1-cHA; 3, pMKIT-neo-hUGT1(V45L)-cHA; 4, pMKIT-neo-hUGT1(N47A)-cHA; 5, pMKIT-neohUGT1(I51T)-cHA; 6, pMKIT-neo-hUGT1(Q89E)-cHA; 7, pMKIT-neo-hUGT1(Q129A)-cHA; 8, pMKIT-neo-hUGT1(L174M)-cHA; 9, pMKIT-neo-hUGT1(I181L)-cHA; 10, pMKIT-neo-hUGT1(Q185K)-cHA; 11, pMKIT-neo-hUGT1(F265Y)-cHA; 12, pMKIT-neohUGT1(V285T)-cHA; 13, pMKIT-neo-hUGT1(N5aaCST)-cHA; 14, pMKIT-neo-hUGT1(C5aaCST)-cHA; 15, pMKIT-neo-hUGT1(10aaCST)cHA; 16, pMKIT-neo-hCST-cHA Fig Suppression of N47A mutation by I51T second-site mutation Lec8 cells transfected with an appropriate plasmid as speci®ed below were stained with FITC-GS-II lectin and anti-HA antibody as in Fig in (A); and cell extracts were subjected to Western blot analysis as in Fig in (B) a, pMKIT-neo; b, pMKIT-neo-hUGT1-cHA; c, pMKIT-neo-hUGT1(N47A)-cHA; d, pMKIT-neo-hUGT1(V45L, N47A)-cHA; e, pMKIT-neohUGT1(N47A, I51T)-cHA; f, pMKIT-neo-hUGT1(V45L, N47A, I51T)-cHA; g, pMKIT-neo-hUGT1(N5aaCST)-cHA; h, pMKIT-neo-hUGT1 (10aaCST)-cHA Bar, 10 lm intracellular distribution (Fig 9A, panel e) and expression level (Fig 9B, lane e) of the double-mutant protein DISCUSSION In this study we determined the primary structure of a putative nucleotide sugar transporter of D melanogaster, and identi®ed it as the D melanogaster homologue (DmUGT) of human UDP-Gal transporter (hUGT) The cDNA complemented the genetic defect of UGT-de®cient Lec8 cells, and its product was detected in the Golgi region of the transfected cells Heterologous expression of the cDNA in S cerevisiae cells allowed us to demonstrate directly that the cDNA product was able to transport UDPGal and UDP-GalNAc across the microsomal membranes (Figs and 6) Ó FEBS 2002 UDP-Gal transporter transports UDP-GlcNAc (Eur J Biochem 269) 137 Nucleotide sugar transporters (NSTs), including hUGT, have long been thought to be highly substrate speci®c [22] Very recently, however, Muraoka et al reported a new member of the NST family, hUGTrel7, and showed that it transports both UDP-GlcA and UDP-GalNAc [16] Hong et al also demonstrated that Leishmania GDP-Man transporter, LPG2, can transport GDP-arabinose and GDPfucose in addition to GDP-Man [23] Speci®c recognition of two or more substrates by an NST may be more common than has been assumed until recently The molecular mechanisms underlying the multiple substrate recognition are intriguing while remaining obscure Various glycoconjugates are detected in a position and stage-speci®c manner during Drosophila development [24] Heparin-like glycosaminoglycans that contain galactose and N-acetylgalactosamine residues are involved in the wingless signaling [25] The DmUGT protein was localized in the Golgi region when the cDNA was expressed in Lec2 and Lec8 cells, and transported both UDP-Gal and UDP-GalNAc The subcellular localization and its substrate speci®city are consistent with its possible involvement in this process RNA interference experiments [26] may help to answer this intriguing question about the physiological role of DmUGT We found a single possible N-glycosylation site in the DmUGT during analysis on the primary structure of the fruit ¯y NST (Fig 1A) Based on the 10-segment transmembrane model proposed by Eckhardt et al [27], the N-glycosylation site resides at the boundary between the ninth and tenth putative transmembrane regions (Fig 2) Eckhardt et al were not able to decide whether these hydrophobic regions (Fig 2; Hxs9 and 10) traverse the membrane, are enbedded in the membrane without being exposed to the lumen side, or are just tightly membrane associated, as anti-HA epitope antibodies failed to detect an HA epitope introduced to this boundary region [27] The expressed DmUGT proteins were glycosylated in both CHO (Fig 3A) and S cerevisiae (Fig 4) cells indicating that the N-glycosylation site found is faced to Golgi lumen and accessible to glycosyl transferases These results suggest that both the ninth and tenth hydrophobic regions form discrete membrane-spanning domains Three amino-acid residues of hUGT, namely N47, L174, and V285, are conserved among human, murine, ®ssion yeast, and Drosophila UGTs, but are distinct from the corresponding residues conserved among CMP-Sia transporters and UDP-GlcNAc transporters, respectively, from several species [15] These Ơsubstrate-speci®cÕ residues as well as several others were replaced by corresponding residues of CMP-Sia transporter, to see whether these residues contribute to the recognition of speci®c substrates, but the switching of the substrate from UDP-Gal to CMP-Sia was not observed with any of the substitution mutants tested This unexpected result is rather consistent with the results recently obtained in analyses of UGT/CST chimeras, indicating that different submolecular regions are critically involved in the recognition of UDP-Gal and CMP-Sia [21,28] The N47A mutation of hUGT led to aberrant intracellular distribution and destabilization of the mutated transporter protein The mutant phenotype of N47A was suppressed by a second mutation, I51T As N47 and I51 are predicted to be close to each other on the same side of the ®rst transmembrane helix based on the 10-segment transmembrane model of the transporter [27], it seems that the intrahelical side-chain interaction between these two residues is important for the conformational stability of the protein and its proper interaction with the membrane protein-sorting machinery The importance of helix in stabilizing the UGT protein may also be inferred from the instability of a truncated Schizosaccharomyces pombe UGT that lacks the exon coding for the ®rst transmembrane helix [6] Aoki et al also demonstrated that the ®rst helix from UGT is necessary for chimeric constructs to transport UDP-Gal [21] Further analysis of the effects of mutations introduced in helix may provide clues to investigate the mechanisms of integration, sorting and substrate-recognition of this polytopic membrane protein ACKNOWLEDGEMENTS This work was supported in part by Grants-in-Aid for Scienti®c Research no 11480172, Grants-in-Aid for Scienti®c Research on Priority Area no 12033222 from the Ministry of Education, Science, Sports and Culture of Japan and a Grant from Mizutani Foundation for Glycoscience REFERENCES Kawakita, M., Ishida, N., Miura, N., Sun-Wada, G.-H & Yoshioka, S (1998) Nucleotide sugar transporters: elucidation of their molecular identity and its implication for future studies J Biochem (Tokyo) 123, 777±785 Seppo, A & Tiemeyer, M (2000) Function and structure of Drosophila glycans Glycobiol 10, 751±760 Herman, T & Horvitz, H.R (1999) Three proteins involved in Caenorhabditis elegans vulval invagination are similar to components of a glycosylation pathway Proc Natl Acad Sci USA 96, 974±979 Abeijon, C., Robbins, P.W & Hirschberg, C.B (1996) Molecular cloning of the Golgi apparatus uridine diphosphate-N-acetylglucosamine transporter from Kluyveromyces lactis Proc Natl Acad Sci USA 93, 5963±5968 Dean, N., Zhang, Y.B & Poster, J.B (1997) The VRG4 gene is required for GDP-mannose transport into the lumen of the Golgi in the yeast, Saccharomyces cerevisiae J Biol Chem 272, 31908± 31914 Segawa, H., Ishida, N., Takegawa, K & Kawakita, M (1999) Schizosaccharomyces pombe UDP-galactose transporter: identi®cation of its functional form through cDNA cloning and expression in mammalian cells FEBS Lett 451, 295±298 Roy, S.K., Chiba, Y., Takeuchi, M & Jigami, Y (2000) Characterization of Yeast Yea4p, a uridine diphosphate-N-acetylglucosamine transporter localized in the endoplasmic reticulum and required for chitin synthesis J Biol Chem 275, 13580± 13587 Ma, D.Q., Russell, D.G., Beverley, S.M & Turco, S.J (1997) Golgi GDP-mannose uptake requires Leishmania LPG2: a member of a eukaryotic family of putative nucleotide-sugar transporters J Biol Chem 272, 3799±3805 Herman, T., Hartwieg, E & Horvitz, H.R (1999) sqv mutants of Caenorhabditis elegans are defective in vulval epithelial invagination Proc Natl Acad Sci USA 96, 967±973 10 Miura, N., Ishida, N., Hoshino, M., Yamauchi, M., Hara, T., Ayusawa, D & Kawakita, M (1996) Human UDP-galactose translocator: molecular cloning of a complementary DNA that complements the genetic defect of a mutant cell line de®cient in UDP-galactose translocator J Biochem (Tokyo) 120, 236±241 138 H Segawa et al (Eur J Biochem 269) 11 Ishida, N., Miura, N., Yoshioka, S & Kawakita, M (1996) Molecular cloning and characterization of a novel isoform of the human UDP-galactose transporter, and of related complementary DNAs belonging to the nucleotide-sugar transporter gene family J Biochem (Tokyo) 120, 1074±1078 12 Eckhardt, M., Mulenho€, M., Bethe, A & Gerardy-Schahn, R (1996) Expression cloning of the Golgi CMP-sialic acid transporter Proc Natl Acad Sci USA 93, 7572±7576 13 Eckhardt, M & Gerardy-Schahn, R (1997) Molecular cloning of the hamster CMP-sialic acid transporter Eur J Biochem 248, 187±192 14 Ishida, N., Ito, M., Yoshioka, S., Sun-Wada, G.-H & Kawakita, M (1998) Functional expression of human Golgi CMP-sialic acid transporter in the Golgi complex of a transporter-de®cient Chinese hamster ovary cell mutant J Biochem (Tokyo) 124, 171±178 15 Ishida, N., Yoshioka, S., Chiba, Y., Takeuchi, M & Kawakita, M (1999) Molecular cloning and functional expression of the human Golgi UDP-N-acetylglucosamine transporter J Biochem (Tokyo) 126, 68±77 16 Muraoka, M., Kawakita, M & Ishida, N (2001) Molecular characterization of human UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter, a novel nucleotide sugar transporter with dual substrate speci®city FEBS Lett 495, 89±93 17 Sarker, G & Sommer, S.S (1990) The ÔmegaprimerÕ method of site-directed mutagenesis Biotechniques 4, 404±407 18 Ito, H., Fukuda, Y., Murata, K & Kimura, A (1983) Transformation of intact yeast cells treated with alkali cations J Bacteriol 153, 163±168 19 Sun-Wada, G.-H., Yoshioka, S., Ishida, N & Kawakita, M (1998) Functional expression of the human UDP-galactose transporters in the yeast Saccharomyces cerevisiae J Biochem (Tokyo) 123, 912±917 20 Yoshioka, S., Sun-Wada, G.-H., Ishida, N & Kawakita, M (1997) Expression of the human UDP-galactose transporter in the Ó FEBS 2002 21 22 23 24 25 26 27 28 29 Golgi membranes of murine Had-1 cells that lack the endogenous transporter J Biochem (Tokyo) 122, 691±695 Aoki, K., Ishida, N & Kawakita, M (2001) Substrate recognition by UDP-galactose and CMP-sialic acid transporters: di€erent sets of transmembrane helices are utilized for the speci®c recognition of UDP-galactose and CMP-sialic acid J Biol Chem 276, 21555± 21561 Hirschberg, C.B., Robbins, P.W & Abeijon, C (1998) Transporters of nucleotide sugars, ATP, and nucleotide sulfate in the endoplasmic reticulum and Golgi apparatus Annu Rev Biochem 67, 49±69 Hong, K., Ma, D., Beverley, S.M & Turco, S.J (2000) The Leishmania GDP-mannose transporter is an autonomous, multispeci®c, hexameric complex of LPG2 subunits Biochemistry 39, 2013±2022 D'Amico, P & Jacobs, J.R (1995) Lectin histochemistry of the Drosophila embryo Tissue Cell 27, 23±30 Binari, R.C., Staveley, B.E., Johnson, W.A., Godavarti, R., Sasisekharan, R & Manoukian, A.S (1997) Genetic evidence that heparin-like glycosaminoglycans are involved in wingless signaling Development 124, 2623±2632 Kennerdell, J.R & Carthew, R.W (1998) Use of dsRNAmediated genetic interference to demonstrate that frizzled and frizzled act in the wingless pathway Cell 95, 1017±1026 Eckhardt, M., Gotza, B & Gerardy-Schahn, R (1999) Membrane topology of the mammalian CMP-sialic acid transporter J Biol Chem 274, 8779±8787 Aoki, K., Sun-Wada, G.-H., Segawa, H., Yoshioka, S., Ishida, N & Kawakita, M (1999) Expression and activity of chimeric molecules between human UDP-galactose transporter and CMP-sialic acid transporter J Biochem (Tokyo) 126, 940±950 Kyte, J & Doolittle, R.F (1982) A simple method for displaying the hydropathic character of a protein J Mol Biol 157, 105±132  ... detected in a position and stage-speci®c manner during Drosophila development [24] Heparin-like glycosaminoglycans that contain galactose and N-acetylgalactosamine residues are involved in the wingless... stability of the protein and its proper interaction with the membrane protein-sorting machinery The importance of helix in stabilizing the UGT protein may also be inferred from the instability of... expression system HA-tagged DmUGT cDNA was inserted into the copperinducible yeast expression vector pYEX-BESN and transfected into S cerevisiae YPH500, and a transformant was obtained We prepared