0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học:

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... 4CAS E REP O R T Open Access Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case reportElaine Lin1, ... as an incidentallaboratory finding. Although leukemias represent onlyabout eight percent of neoplastic metastases to the heart, almost 50% of lymphoma patients have cardiac involvement at autopsy ... the assump-tion that the tamponade was most likely due to a viralcause, although Coxsackie and adenoviral titers werenegative. It was the late appearance of circulating immu-noblasts that finally...
  • 4
  • 398
  • 0
Báo cáo y học:

Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... 4CAS E REP O R T Open Access Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case reportElaine Lin1, ... mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report. Journal of Medical Case Reports2010 4:246.Lin et al. Journal ... as an incidentallaboratory finding. Although leukemias represent onlyabout eight percent of neoplastic metastases to the heart, almost 50% of lymphoma patients have cardiac involvement at autopsy...
  • 4
  • 399
  • 0
Báo cáo y học:

Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

... Correspondence: rashi.l.singhal@gmail.com The University of Alabama at Birmingham, Huntsville, Alabama, USASinghal and Corman Journal of Medical Case Reports 2011, 5:59http://www.jmedicalcasereports.com/content/5/1/59JOURNAL ... this article as: Singhal and Corman: Subacute herpes simplex virustype 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report. Journal of ... signal intensity of the basal meninges, particularly involving the left cerebellar peduncle (A) and the right anteriormesencephalic-pontine junction (B).Singhal and Corman Journal of Medical Case...
  • 7
  • 403
  • 0
Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

... de Salamanca, Edi®cio Departamental, Avda, Salamanca,Spain;2Centro Hispano-Luso de Investigaciones Agrarias, Universidad de Salamanca, Edi®ci o Departamental, Avda, Salamanca,Spain The Phycomyces ... analysisNucleotide and amino-acid sequences were analysed u sing the Vector NTI Suite software package (InforMax, Inc.).Access to the PROSITE database of protein families anddomains was carried ... one of the most abundant and widelydistributed classes of pigment in nature. They are present in photosynthetic bacteria, c yanobacteria, algae and higherplants as well as in nonphotosynthetic...
  • 7
  • 479
  • 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

... (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), 4 ( CAACGTCATAGACGATTACATTG CTACATGGAGCTGTCTAGAGGATCCGA). A three-strandjunction was made by o mitting strand 4 and a 37-bp duplexDNA by annealing ... labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT),2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), ... junctions. SPR analysis alsoshows that the EcRuvA and MpRuvA bind to the DNAwith fast association rate c onstants (k a ). This results in mathematical mo dels that poorly fit the data, and calcula-tions...
  • 9
  • 542
  • 0
Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt

Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt

... temperature. The ATPase activity wasdetermined as described in Materials and methods and calculatedrelative to the activity measured in absence of surfactant. Error barsindicate standard deviations. ... bilayer. The hydrolysis of ATP by both NBDs of MRP1 wasdependent on divalent cations and was inhibited by ATPaseinhibitors, such as ortho-vanadate and azide. Our dataindicate that both NBDs of ... nonspecificeffect of S-decyl-glutathione. As S-decyl-glutathione comprises an alkyl chain, it mayact as a surfactant. After having already determined thatS-decyl-glutathione is capable of forming micelles at...
  • 9
  • 564
  • 0
Báo cáo y học:

Báo cáo y học: "Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β" docx

... protein Forward, GCATCAAGTGGACCAAGCTAReverse, GTAACTCCAATGCCACCACACollagen alpha 1 type II Forward, GTGGAGCAGCAAGAGCAAGGAReverse, CTTGCCCCACTTACCAGTGTGCXCL5 (LIX) Forward, CACCCTGCTGGCATTTCTGReverse, ... central player in inflammatorysignal transduction, IL-1 and TNF also share the capacity toactivate the stress-activated protein kinase/c-Jun N-terminalkinase and p38 mitogen-activated protein ... with the capacity todrive the key pathways typically associated with the pathogen-esis of OA. As shown here, as well as by others, IL-1 abruptlyshifts the metabolism of the chondrocyte stimulating...
  • 14
  • 404
  • 0
Báo cáo y học:

Báo cáo y học: "HLA-C locus alleles may modulate the clinical expression of psoriatic arthritis" potx

... was also analysed in the three groups of PsA. The strength of the association between HLA-C/B27 antigensand disease was calculated by odds ratio (OR), and the statis-tical significance of these ... genes. The latter may explain why someHLA genes originally associated with PsA susceptibility arenow being considered part of the ancestral haplotypes relatedto psoriasis risk rather than true associations ... joints were defined as having polyarthritis; and patients with inflammatory back painand bilateral grade II or unilateral grade III or more X-ray sacro-iliitis were grouped as having spondylitis,...
  • 5
  • 369
  • 0
Báo cáo y học:

Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

... com-plaints of increased swelling, stiffness, pain, and warmth in the right wrist. Her wrist was re-imaged. An increase in swelling,particularly on the dorsolateral aspect of the wrist, was visuallyapparent ... inflammatory state of the jointwould improve the ability to quantify disease activity. Such a measure could be used to assess response to therapy in both the clinical and research settings. A ... overallimprovement in the reliability of the ACR 20 and ACR 30.We used a non-contact 3D laser scanning device used byother investigators to obtain objective and quantifiable data of the physical characteristics...
  • 9
  • 344
  • 0
Báo cáo y học:

Báo cáo y học: "Mannose-binding lectin deficiency is associated with early onset of polyarticular juvenile rheumatoid arthritis: a cohort study" pdf

... The influence of the X /Y allele was also determined by studying six'extended' genotype groups: YA/YA, YA/XA, XA/XA, YA/O,XA/O and O/O.Statistical analysisData are presented as median and ... agents in the host may enhance synovial inflammation because of the proin-flammatory effects of bacterial DNA and bacterial cell wallfragments [35,36]. Anti-MBL autoantibodies may also play ... first time. The clinical examination included a phy-sician's global assessment (PGA) of overall disease activity(ranging from 0 to 5) as well as assessment of numbers of actively involved...
  • 11
  • 401
  • 0

Xem thêm

Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012chuyên đề điện xoay chiều theo dạngNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢP