Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae Stuart M. Ingleston 1 , Mark J. Dickman 2 , Jane A. Grasby 3 , David P. Hornby 2 , Gary J. Sharples 4 and Robert G. Lloyd 1 1 Institute of Genetics, University of Nottingham, Queen’s Medical Centre, Nottingham, UK; 2 Transgenomic Research Laboratory, Krebs Institute, Department of Molecular Biology and Biotechnology, University of Sheffield, UK; 3 Krebs Institute, Centre for Chemical Biology, University of Sheffield, UK; 4 Department of Biological Sciences, University of Durham, UK The RuvA, RuvB and RuvC proteins of Escherichia coli act together to process Holliday junctions formed during recombination and DNA repair. RuvA has a well-defin ed DNA binding surface that is sculptured specifically to accommodate a Holliday junction and allow subsequent loading of RuvB and RuvC. A negatively charged pin pro- jecting from th e centre limits b inding of linear duplex DNA. The a mino-acid sequences forming the pin are highly con- served. However, in certain Mycoplasma and Ureaplasma species the structure is extended by f our amino acids and two acidic residues forming a crucial charge barrier are missing. We investigated the signific ance of these d ifferences by analysing RuvA from Mycoplasma pneumoniae. Gel retar- dation and surface plasmon resonance assays revealed that this protein binds Holliday junctions and other branched DNA structures in a manner similar to E. coli RuvA. Sig- nificantly, it binds duplex DNA more readily. However it does not support branch migration mediated by E. coli RuvB and when bound to junction DNA is unable to pro- vide a platform for stable binding of E. coli RuvC. It also fails to restore radiation resistance to an E. coli ruvA mutant. The data p resented suggest that the modified pin region retains the ability to promote junction-spe cific DNA bind- ing, but acts as a physical obstacle to linear duplex DNA rather than as a charge barrier. T hey also indicate that such an obstacle may interfere with the binding of a resolvase. Mycoplasma species may therefore process Holliday junc- tions via uncoupled branch migration and resolution reac- tions. Keywords: recombination; DNA repair; RuvABC resolva- some. The formation and s ubsequent processing of Holliday junctions are key stages in recombination and DNA repair that provide the means to repair b roken DNA molecules, generate recombinants in genetic crosses and rescue repli- cation forks s talled at lesions in the template strands [1–4]. Once formed, t hese four-way branched DNA structures are targeted by junction-specific DNA helicases and endonuc- leases that act, respectively, to move the branch point along the DNA (branch migration) and to cut specific DNA strands at or near the crossover, thus releasing duplex DNA products (resolution). In Escherichia c oli, the resolution reaction appears to be coupled to branch migration via the formation of a specialized molecular machine composed of three p rotein s ubunits, RuvA, RuvB and RuvC [5,6]. A tetramer of RuvA binds one face of an open Holliday junction to form a specific complex that supports the loading of two RuvB ring helicases on opposing duplexes and of a dimer of RuvC endonuclease on the other face of the junction in the space between the RuvB rings [ 7,8]. Th e RuvAB proteins catalyse junction branch migration while RuvC resolves the structure to duplex products by intro- ducing a pair of symmetrically related incisions at specific sequences as the DNA strands move through the complex [8–10]. The RuvA protein plays a pivotal role in processing Holliday junctions. I t functions as a s pecificity factor f or junction binding, provides a RuvA-junction scaffold for assembly of RuvB and RuvC, and actively participates in the b ranch migration and resolution reactions [11,12]. The atomic structure of RuvA reveals four L -shaped monomers comprising a fourfold symmetrical platform uniquely adapted for binding four-way branched DNA molecules [13,14]. Grooves on the concave surface of the tetramer accommodate each duplex arm o f the junction in an open square conformation [13–16]. Two helix-hairpin-helix motifs from each monomer make co ntacts with the phosphodiester backbone on the minor groove side of e ach duplex arm of the junction [16,17]. The junction can be bound by a single tetramer of R uvA [15,16] or en closed between two tetramers [18]. It is not known if binding o f a single tetramer of RuvA is sufficient f or branch migration by RuvAB. This reaction may require a double tetramer of RuvA or the assembly of a RuvABC resolvasome to anchor the complex [18]. In the case of the octameric RuvA complex, one of the tetramers would need to be released to permit loading of RuvC for Holliday junction resolution. At the intersection of the grooves, negatively charged pins consisting of Glu55 and Asp56 from each monomer project towards the centre of t he Holliday junction [13,14]. The four pairs of negative charges prohibit binding of duplex DNA across the centre of the tetram er and ensure high junction Correspondence to R. G. Lloyd, Institute of Genetics, University of Nottingham, Queen’s Medical Centre, Nottingham, NG7 2UH, UK. Fax: + 0 1 15 9709906, Tel.: + 0115 9709406, E-mail: bob.lloyd@nottingham.ac.uk Abbreviations: bio, biotin; SA, streptavidin; RU, response units. (Received 1 November 2001, revised 3 J anuary 2002, accepted 22 January 2002) Eur. J. Biochem. 269, 1525–1533 (2002) Ó FEBS 2002 specificity [12]. Both acidic residues m ay also participate directly in the branch migration reaction by forming water- mediated contacts with unpaired bases [16]. Mutations that alter the charge on these residues stimulate the rate of branch migration and attenuate the enhanced junction resolution observed with the RuvABC complex [ 12]. The negatively charged pin of RuvA is conserved in almost all bacteria w ith the exception of three species, Mycoplasma pneumoniae, M. genitalium and Ureaplasma urealyticum. Mycoplasmas belong to the class Mollicutes and are most closely related to Gram-positive bacteria, although their genomes have experienced a drastic com- pression in size. In t his work w e have examined the properties of M. pneumoniae RuvA (MpRuvA) protein to determine the function of the m odified p in. The interaction between MpRuvA and branched DNA substrates and its inability to form heterologous co mplexes w ith E. coli Ruv proteins reveal important differences in junction binding and processing by Mycoplasma species. MATERIALS AND METHODS Strains and plasmids E. co li K-12 strains AB1157 (ruv + ), SR2210 (ruvA200), TNM1208 (DruvAC65 rus-1) have been described previ- ously [25,29]. Strain SI171, a DruvAC65 derivative of BL2 1 (DE3), was used for overexpression of RuvA proteins [17]. EcRuvA was overexpressed from the pT7-7 construct, pAM159 [17]. The Mycoplasma pneumoniae M129 [30] ruvA gene was recovered by PCR from genomic DNA obtained from R. Herrmann (Universita ¨ t Heidelberg, Germany). Oligonucleotides (5 ¢-AAACTAAGG CATATGATTGCT TCAA-3¢ and 5 ¢-TGCGCCTTAT GGATCCGGGACG CTT-3¢) were designed t o amplify the gene and provided NdeIandBamHI sites (underlined) f or cloning the PCR product in pT7-7. The resulting construct, pSI66, was used for o verexpression of Mp RuvA.CellsweregrowninLB medium supplemented with ampicillin (50 lgÆmL )1 )as required for maintenance of plasmids. Sensitivity to UV light was measured as described [25]. Protein purification Purification of MpRuvA followed a similar protocol to that described f or EcRuvA [17,31]. RuvB and R uvC proteins were overexpressed and purified as described previously [32,33]. Protein concentrations were estimated by a modified Bradford assay using a Bio-Rad assay kit and bovine serum albumin as standard. Amounts of RuvA, RuvB and RuvC are expressed as m oles of the monomeric protein. DNA substrates Oligonucleotide synthesis was performed on an Applied Biosystems 394 DNA synthesiser using cyanoethyl phos- phoramidite chemistry. The biotin phosphoramidite was obtained f rom Glen Research. DNA substrates were prepared by annealing a ppropriate oligonucleotides follow- ing t he procedure described by Parsons [34]. The seq uence of oligonucleotides used for the 50 bp junctions J11 and J12, containing mobile cores of 1 1 a nd 12 bp, respectively, have been described [23,24], as have those for Y junction and linear duplex DNA substrates [20,24]. Gel retardation and branch migration assays used substrates in which a single strand had been 5¢ 32 P-labelled using [c- 32 P] ATP and polynucleotide kinase prior to annealing. For SPR analysis the following oligonucleotides were used to make a 50-bp static junc tion, J0, labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing oligonucleotides 5 (bio-AATGCTA CAGTATCGTCCGGTCACGTACAACATCCAG) and 6 (CTGGATGTTGTACGTGACCGGACGATACTGT AGCATT). Gel retardation assays Binding mixtures (20 lL) contained 0.2 ng 32 P-labelled J11, Y j unction, or linear duplex DNA in 50 m M Tris/HCl pH 8.0, 5 m M EDTA, 1 m M dithiothreitol, 100 lg/mL BSA and 6% (v/v) glycerol. Samples were incubated on ice with RuvA protein for 10 min prior to loading onto a 4% polyacrylamide gel in low ionic strength buffer (6.7 m M Tris/HCl pH 8.0, 3.3 m M sodium acetate, 2 m M EDTA). In RuvAC-junction assays, RuvA was added prior to the addition of RuvC. Electrophoresis was at 160 V for 90 min with continuous buffer circulation. Gels were dried and analysed by autoradiography and phosphorimaging. Branch migration assays Reaction mixtures (20 lL) contained 0.2 ng o f 32 P-labelled J12 in 20 m M Tris/HCl pH 7.5, 5 m M EDTA, 2 m M dithiothreitol, 100 lgÆmL )1 BSA. RuvA protein was added before RuvB and reactions incubated at 37 °Cfor30min and terminated by t he addition of 5 lLofstopmix(2.5% SDS, 200 m M EDTA, 10 mgÆmL )1 proteinase K) with incubation for a further 10 min. Reaction products were separated on 10% PAGE in Tris/borate/EDTA buffer (89 m M Tris/HCl, pH 8.0, 89 m M borate, 2.5 m M EDTA) at 160 V for 9 0 min and analysed as described above. Surface plasmon resonance Surface plasmon resonance was performed using a BIAcore 2000 TM (Uppsala, Sweden). Oligonucleotides were diluted in buffer [10 m M Hepes pH 7.4, 150 m M NaCl, 3 m M EDTA, 0.05% (v/v) surfactant P20] to a final concentration of 1 ngÆmL )1 and passed o ver a streptavidin (SA) sensor chip at a flow rate of 10 lLÆmin )1 until approximately 100– 200 response units (RU) of the oligonucleotide was bound to the sensor chip surface . Proteins were a lso diluted in Hepes/Na Cl/P i /EDTA/P20 and a range of concentrations (4–8000 n M ) w ere i njected over the DNA-charged sensor chip at a flow rate of 20 lLÆmin )1 for 3 min and allowed to dissociate for 5 min. Bound protein was removed by injecting 10 lLof1 M NaCl. This regeneration p rocedure did not alter the ability of EcRuvA to bin d Holliday 1526 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002 junction. Analysis of the data was performed using BIA- EVALUATION software. T o r emove t he effects of t he bulk refractive index change at the beginning and end of injections (which occur as a re sult of a difference in the composition of the running buffer and the injected protein), a control sen sorgram obtained over t he streptavidin s urface was subtracted from each protein injection. Kinetic analysis The dissoc iation rate constants were calculated using linear regression analysis assuming a zero order dissociation using the equation: dR=dt ¼ k d R 0 e Àk d ðtÀt 0 Þ where dR/dt is the rate of c hange of t he SPR signal, R and R 0 , is the response at time t and t 0 . k d is the dissociation rate constant. Equilibrium binding analysis BIAcore equilibrium binding experiments were performed as described [35] with minor modifications. The instrument was equilibrated at 2 5 °Cwith10m M Hepes, pH 7.4, 150 m M NaCl, 3 m M EDTA, 0.05% (v/v) surfactant p20 at a flow rate of 100 lLÆmin )1 . Baseline data were collected for 45 min at the start of t he experiment, b efore the incorpor- ation o f t he prote in into the running buffer. After equilib- rium binding profiles had been generated, the responses from the four flow cells were baseline corrected during t he initial w ashing phase. The r esponse from t he reference flow cell was subtracted from the other three flow cells to correct for refractive index changes, nonspecific binding and instrument drift. RESULTS The modified pin structure of Mp RuvA The negatively charged pin of E. co li RuvA (EcRuvA) has two acidic r esidues (Glu55 and Asp56) flanked by b sheets [13,14]. This arrangement is conserved in the RuvA sequences from 45 other b acterial species [12] (Fig. 1A and data not shown), which suggests that the pin architectures are probably very similar, as demonstrated for Mycobacte- rium leprae RuvA [18]. However, three bacterial species (M. pneumoniae, M. genitalium, and Ureaplasma urealyti- cum) carry RuvA orth ologs in which the sequences forming the pin region differ significantly from this pattern (Fig. 1B). These RuvA p roteins have a n additional four amino acids and l ack acidic residues at the apex of the intervening loop. Acidic residues that may potentially compensate for the loss of the negative charge are located nearby in the two Mycoplasma sequences but are positioned in the region corresponding to b sheet 6 in the EcRuv A structure [17]. The global structure of the two RuvA proteins would have to be radically altered t o accommodate these r esidues in the same position as in EcRuvA. In addition, only one acidic residue is retained in U. urealyticum RuvA (Fig. 1B). However, c on- servation o f sequences in the flanking b sheets suggests that the g eneral architecture of the pin is probably m aintained. Thus, the likely net effe ct of the altered sequence between b5 and b6 is to produce an extended a nd uncharged pin. Interaction of Mp RuvA with a Holliday junction To investigate the effect of these alterations in pin structure on the DNA binding properties of RuvA we purified the Mycoplasma pneumoniae RuvA protein and compared its activity with that of EcRuvA. The protein was o verex- pressed in a DruvAC derivative of E. coli BL21 (DE3) to prevent contamination with EcRuvA and purified using t he procedure devised previously. A synthetic Holliday junction containing an 11-bp mobile core was used as a substrate in gel retardation assays to assess the ability of the protein t o bind junction DNA. Both MpRuvA and EcRuvA bound the junction. Each formed two distinct complexes (Fig. 2A). In the case of the E. coli protein, the two complexes represent the binding of either a single tetramer of RuvA (complex I) or of two tetramers (complex II). The data presented i ndicate that MpRuvA has the ability t o f orm similar complexes. However, Mp RuvA complex II appears less stable as most of the j unction is found in complex I (Fig. 2 A, lanes l–t). In both cases, 100 n M of protein was sufficient to bind all of the junction DNA mole cules (Fig. 2 A, lane j and t). Further quantitative studies revealed that MpRuvA may have a slightly higher affinity for junction DNA than EcRuvA (Fig. 2B). The k d values estimated from t hese data were 18 n M for MpRuvA and 42 n M for EcRuvA. Specificity of Holliday junction binding by Mp RuvA The E. coli RuvA protein targets four-way junctions with high specificity [19,20]. Mutations that reduce the net charge on each subunit r esult in a significant increase in affinity for duplex DNA [12]. We investigated the junction specificity of MpRuvA by analysing its binding to a Y-shaped junction and to linear duplex DNA. Like the E. coli protein, MpRuvA formed two complexes with a Y junction. However, as with the f our-way junction, only small amounts of complex II were detected, which again suggests that the loading of two tetramers is less favoured (Fig. 3A). No binding to linear duplex DNA was detected with EcRuvA (Fig. 3B, lanes b and c) in keeping with its high selectivity for branched molecu les. However, traces of two complexes we re d etected w ith Mp RuvA, even at relatively low concentrations of protein (Fig. 3B, lanes d and e). To analyse the structure specificity of MpRuvA more quantitatively we m ade use of surface plasmon resonance. Biotinylated DNA substrates [a Holliday junction (J0) lacking a homologous core, a th ree-strand derivative of J0, and duplex DNA] were immobilized on different flow cells on a streptavidin sensor chip. The binding of EcRuvA and MpRuvA to these substrates was examined and the results are shown in Fig. 3C,D. EcRuvA showed the expected preference for Holliday junction DNA over both three- strand and duplex DNA as evident from t he gradient of dissociation illustrate d on the sensorgram (Fig. 3C). Disso- ciation rate constants were c alculated u sing the equation described in Materials and methods. Whilst this equation may not fit the entire range of protein concentrations under all of the experimental conditions described here, it repre- sents the best case scenario, a s the analysis is comparative in nature and describes the net stability of the protein:DNA complex. The rate constants reveal a three to fourfold difference between the linear duplex/three-strand substrates Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1527 and Holliday junction bound by Ec RuvA (Table 1), illustrating the additional stability of the Holliday junc- tion-RuvA complex. The binding of the MpRuvA is shown in Fig. 3D and shows little difference in the dissociation rate constants for the three different DNA-MpRuvA complexes, demonstrating that these complexes have equal stabilities. Figure 3E shows a direct comparison of the binding of EcRuvA an d MpRuvA to linear duplex DNA and shows the additional stability of the MpRuvA bound DNA complex c ompared to the EcRuvA bound DNA complex. But the results also show an increase in the amount of MpRuvA binding to duplex DNA compared to Ec RuvA, as indicated by t he response (Figs 3C–E). MpRuvA also formed a complex with a short 24 bp duplex that was not bound detectably by Ec RuvA (data not shown). The SPR data are broadly consistent with the results obtained f rom gel retardation assays confirming that MpRuvA has a reduced specificity for Holliday junctions. SPR analysis also shows that the EcRuvA and MpRuvA bind to the DNA with fast association rate c onstants (k a ). This results in mathematical mo dels that poorly fit the data, and calcula- tions using k a and k d to obtain the equilibrium dissociation constant would be erroneous. Equilibrium binding analysis was p erformed to further analyse the interaction of Mp RuvA with Holliday junction and duplex DNA (Fig. 4). RuvA protein was placed directly in the running buffer and continually passed over the sensor chip surface containing duplex or Holliday junction attached to different flow cells. The binding profile of the MpRuvA inte raction w ith these DNA substrates is shown in Fig. 4A. The sensorgram reveals that MpRuvA protein, like EcRuvA (Fig. 4B), binds with high affinity to the Fig. 1. The modified pin s tructure of MpRuvA. (A) Structure of the EcRuvA- Holliday junction DNA complex [15]. A tetramer of R uvA (opposing monomers are in shades of grey) binds the Holliday junction in an open square conformation. The duplex arms o f the junction are bo und in grooves on th e concave surface o f the protein a nd converge at a centrally located pin structure fo rm ed by Glu55 and Asp56 (red) i n each RuvA subunit. (B) Alignment of bacterial RuvA p roteins showing conservation of the p in region. Residues 42–65 of EcRuvA are aligned with homologous sequen ces from selected bacterial species. Residues conserved in the m ajority of RuvA sequences f rom 46 bacteria (data not shown) are highlighted in bold. Arrows denote the pos ition of b sheets 5and6intheEcRuvA structure [14,17]. Acidic pin residues are highlighted in red, as are negatively charged residues located nearby in the Ruv A sequences from M. pneumoniae, M. genitalium,and U. ur ealyticum. 1528 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002 Holliday junction at relatively low concentrations of protein (0.112 and 1.12 n M ). Binding to duplex DNA is not observed until a concentration of 1 1.2 n M is passed over the sensor c hip surface (Fig. 4A). Significantly, these results reveal that MpRuvA has a higher affinity for duplex DNA than the EcRuvA protein. Binding of EcRuvA to duplex DNA is not evident until a concentration of 90.4 n M is reached (Fig. 4B). Thus MpRuvA bound to t he duplex at a 10-fold lower concentration and assuming the mechanism and mode of binding is the same, the MpRuvA has a 10-fold higher affinity for duplex DNA. Despite this difference, MpRuvA retains H olliday junction specific ity with s imilar kinetics and stoichiometry as EcRuvA. Mp RuvA is unable to interact with E. coli RuvB and RuvC proteins RuvA and R uvB mediate the branch migration of Holliday junctions and in vitro promote the dissociation of synthetic junction su bstrates to yield flayed duplex products [19]. We examined MpRuvA to see if it could form a branch migration complex with E. coli RuvB. Heterologous branch migration activity has previously been demonstrated using M. leprae RuvA with E. coli RuvB [21] and E. coli RuvA with Thermus thermophilus RuvB [22]. MpRuvA was incubated with E. coli RuvB and synthetic Holliday junc- tion J12 in reactions containing Mg 2+ and ATP ( Fig. 5 A, lanes j –p). In contrast to reactions containing EcRuvA (Fig. 5A, lanes b–h), no unwinding of the synthetic Holliday junction was detected in reactions containing MpRuvA. Similar results were obtained using other junctions differing in sequence and length of mobile core (data not shown). The results indicate that MpRuvA is unable to form a functional branch migration complex with E. coli RuvB. The coupling o f branch m igration and resolution medi- ated by the E. coli RuvABC resolvasome complex requires the binding of RuvA to one face of the junction and RuvC to the other [8,9]. Complexes formed by the loading of both RuvA and RuvC on a synthetic junction can be detected using a gel retardation assay [23]. W e used such an assay to Fig. 2. Holliday ju nction binding by MpRuvA. (A) Gel retardation assay showing the formation of complexes I and II with junction J11. Binding mixtures cont ained 0 .2 ng 32 P-labelled J11 DNA and 0, 0.1, 0.5, 1, 2, 5, 10, 20, 50, and 100 n M of EcRuvA (lanes a–j) or MpRuvA (lanes k–t) prot eins. (B) Titration o f MpRuvA and EcRuvA showing the relative binding of J11. Values are the mean of two independent experiments and are b ased on the f raction of the to tal DNA bound. Fig. 3. Interaction of MpRuvA with branched DNA structures and lin- ear du plex molecules. (A) Gel retardation assay showing binding of RuvA prote ins to a Y-ju nction DNA substrate. Reac tions contained 0.2 ng 32 P-labelled DNA and RuvA at 2 n M (lanes b an d d) or 20 n M (lanes c and e). (B) Gel retardation assay showin g binding of RuvA proteins to linear duplex DNA. Reactions contained 0.2 ng 32 P-labelled DNA and R uvA at 1 0 n M (lanes b and d) or 100 n M (lanes c and e). (C) Surface plasmon resonance sensorgram sho wing binding of EcRuvA (8 l M ) to duplex, three-strand and Holliday junction DNA. (D) Surface plasmon resonance sensorgram showing binding of MpRuvA (6.4 l M ) to d uple x, t hree-stran d a nd J0 DNA. (E) S urfac e plasmon resonance sensogram showing the binding of EcRuvA (6 l M ) and MpRuvA (4 l M )toduplexDNA. Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1529 investigate whether E. coli RuvC could b ind a junction already bound by MpRuvA. With 200 n M RuvC an d l ow concentrations of Ec RuvA, a RuvA/junction/RuvC com- plex was visualized (Fig. 5B, lanes c and d). No such complex could be detected using Mp RuvA (Fig. 5B, lanes l–r). The only complexes seen were those f ormed b y t he binding of RuvC alone or of a double tetramer of Mp RuvA (complex II). The absence of Mp RuvA complex I may be significant, especially as this is the predominant c omplex formed in the absence of RuvC (Fig. 2A). It i s possible that such complexes do bind RuvC but that such binding destabilizes the RuvA–junction interaction. Effect of Mp RuvA on DNA repair in E. coli ruv mutants The ability of Mp RuvA protein t o promote D NA repair in vivo was i nvestigated by introducing plasmid constructs encoding MpRuvA or EcRuvA into E. coli strains SR2210 (ruvA200)andtheruv + control, AB1157. The plasmid expressing MpRuvA (pSI66) failed to improve the UV sensitivity of the ruvA mutant SR2210 (Fig. 6A), which is not surprising given that MpRuvA fails to form productive interactions with E. coli RuvB or RuvC. Indeed, s urvival was a ctually reduced. This n egative effect is most likely due to MpRuvA blocking the access of other junction process- ing enzymes such as RecG [24]. Expression of MpRuvA also reduced survival of the ruv + AB1157 strain (Fig. 6B). However, the effect was rather modest and we conclude that overexpression of MpRuvA does not interfere significantly with junction processing by the r esident E. coli RuvABC system. To further investigate the ability of Mp RuvA to block junction processing in vivo, we made use of strain TNM1208 (DruvAC rus-1). This strain lacks the RuvABC resolution pathway due to deletion of the ruvA and ruvC genes. However, it is resistant to UV light because the rus-1 mutation activates an alternative resolvase (RusA) that is able to process Holliday junctions very efficiently in the Table 1 . Dissociation rates fo r MpRuvA and EcRuvA-DNA complexes. DNA Dissociation rate constant (k d ) (1/s) ± SD a MpRuvA EcRuvA Holliday junction 6.1 · 10 )4 ± 2.2 · 10 )5 5.5 · 10 )4 ± 4.2 · 10 )5 Three-strand junction 7.4 · 10 )4 ± 3.0 · 10 )5 17 · 10 )4 ± 1.9 · 10 )4 Duplex 6.2 · 10 )4 ± 2.3 · 10 )5 19 · 10 )4 ± 2.2 · 10 )4 a Determined using surface plasmon resonance analysis. Fig. 4. Equilibrium bind ing profiles of MpRuvA and EcRuvA on Holl- iday junction (J0) and linear duplex DNA substrates. (A) MpRuvA was incorporated in the running buffer at concentrations of 0.0112 n M (a), 0.112 n M (b), 1.12 n M (c) and 11.2 n M (d). (B) EcRuvA was incor- porated in the running buffer at concentrations of 0.00904 n M (a), 0.0904 n M (b), 0.904 n M (c), 9.04 n M (d) and 90.4 n M (e). The arrows indicate the tim e at which the concentration of the protein was altered. Fig. 5. Interactions between RuvA and either Ruv B or RuvC. (A) B ranch m igration assay showing the dissociation of H olliday junction to flayed duplex products. Reaction s contained 0.2 ng 32 P-labelled J12 DNA and proteins a s indicated. ( B) Gel r etardation assay s howing the f orma tion of RuvAC-junction complexes. Binding mixes contained 0.2 ng 32 P-labelled J12 DNA and proteins as indi- cated. 1530 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002 absence of RuvABC [25–27]. The introduction of a p lasmid expressing EcRuvA into this strain increases sensitivity to UV light (Fig. 6C), presumably by blocking Holliday junction resolution by RusA [17]. The plasmid encoding MpRuvA also increases sensitivity t o UV, but the effect is considerably less severe (Fig. 6C). This finding suggests that MpRuvA is less able to inhibit t he processing o f Holliday junctions in vivo than Ec RuvA despite the fact that both bind synthetic Holliday junctions with similar affinities in vitro (Fig. 2A). DISCUSSION The n egatively charged central pin on the DNA binding surface of RuvA plays a crucial role in junction targeting and processing. It c onstrains the r ate of branch migration by RuvAB and influences resolution by RuvABC [12]. The importance of this structure is reflected in the high conservation of the sequences forming the pin in th e majority of bacteria with the exception of two Mycoplasma species and one of Ureaplasma. In t he RuvA p roteins from these organisms the pin sequence is extended by four residues and lacks negatively charged residues at the apex of the structure. We investigated the properties of the RuvA protein from M. pneum oniae to see how these modifications affected its interaction with DNA. The MpRuvA protein bound the four-way branched Holliday junction structure with a high affinity. However, relative to EcRuvA, it displayed a n increased af finity for Y-shaped duplex DNA structures, three-strand junctions and linear duplex DNA. I ts affinity for linear duplex DNA is app roximately 10-fold higher than the E. coli protein. The results suggest that the m odified pin influences the a bility to bind duplex DNA and is consistent with observations by Ingleston et al. [12] showing that mutations in EcRuvA that reduce the net negative c harge on t he pin, or which add positive c harges, r esult in an increase i n b inding to duplex DNA. As with the E. coli protein, we found that a synthetic Holliday junction c an bind e ither one or two tetramers of MpRuvA. However the octameric complex (complex II) appears less s table than t hat formed w ith EcRuvA. As the pinregionofMpRuvA contains an additional f our amino acids it is likely that the pin i s extended and this extension could cause steric clashes across t he central cavity of the open H olliday junction that interfere with stable binding of a tetramer on both f aces. The reduced stability of the octamer c omplex may explain the modest negative effect of MpRuvA compared with EcRuvA on DNA repair mediated by the RusA resolvase in strain TNM1208 (Fig. 6 C). This protein forms a very stable octameric complex and when overexpressed is therefore much more likely to prevent RusA gaining acce ss to a Holliday junction. Single tetramers of EcRuvA and MpRuvA bind junction DNA with similar affinities. However, such complexes are less likely to inhibit R usA a s one face of the junction would remain free of protein and this may be sufficient for RusA to loa d on the DNA and resolve the structure. We found that MpRuvA is unable to p romote DNA repair in E. coli ruvA mutants. This is most lik ely a consequence of its failure to assemble a f unctional branch migration c omplex with E. coli RuvB. Certain conserved residues in domain III of EcRuvA (Leu16 7, Leu170, Tyr172 and Leu199) a re known t o participate in protein–protein interactions with Ec RuvB [1 1,14]. MpRuvA has the first three of these residues but differs in the replacement of Leu199 with isoleucine. It is possible that this subtle change accounts f or the inactivity of the hybrid MpRuv A-EcRuvB branch migration motor, altho ugh other differences affect- ing the architecture of MpRuvA domain III cannot be excluded. Mycobacterium leprae RuvA, w hich retains a conserved leucine at this position, forms an active branch migration complex with EcRuvB [21]. Compensatory changes in the MpRuvB sequence should correspond to the alterations in MpRuvA that prevent heterologous contacts with EcRuvB. Isoleucine r esidues at positions 148 and 150 in EcRuvB are critical for the formation of complexes with EcRuvA [28]. In MpRuvB these amino acids are replaced by the alternative hydrophobic residues, valine and methionine, respectively. These substitutions at the MpRuvA–RuvB interface are likely to be responsible for blocking the formation of functional complexes between MpRuvA and EcRuvB. We also found that E. coli RuvC was unable to form a complex w ith a junction already bound by MpRuvA, at least not o ne stable e nough t o be d etected in a gel retardation assay. In common with other Gram-positive bacteria, M. pneumoniae lacks a homologue of RuvC [6]. It is therefore possible that branch migration and resolution are uncoupled in these species [18]. The assembly o f a RuvABC complex i s ne cessary for e fficient resolution o f Holliday junctions in E. coli and presumably imposes constraints on the evolution of each Ruv protein. In particular, RuvA may have to maintain a compact acidic pin that does not project at the junction core so that the conformation of the RuvA-bound junction allows stable loading of R uvC. In the absence of a R uvC, the c onstraints on MpRuvA would be reduced and limited to those factors necessary for junction b inding and t he loading o f RuvB. However, s everal Gram-positive bacteria that lack RuvC apparently retain the conserved pin architecture of EcRuv A [6,12]. In fact, M. pulmon is RuvA has a pin that more Fig. 6. Survival of UV-irradiated Escherichia coli strai ns carrying plasmids expressing either MpRuvA or EcRuvA proteins. (A) Strain SR2210 ( ruvA 200 ). (B) Strain AB1157 (ruv + ). (C) Strain TNM1208 (ruvAC rus-1). The plasmid constructs used are i dentified in (B). Values are the me an of at least t wo independent experiments. Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1531 closely resembles the standard pattern rather than its closely related Mollicutes (Fig. 1B). In addition, M. leprae RuvA, which has an apparently identical pin to EcRuvA, also f ails to form junction complexes with EcRuvC in a gel retarda- tion assay, perhaps suggesting t hat there are stabilizing contacts across the j unction that are i ndependent of pin structure [21]. Clearly there are subtle differences in the way Holliday junctions are processed by Mycoplasmas.Further insights into the mechanism of Holliday junction branch migration and resolution await the identification and characterization of t he novel resolvase employed in Gram- positive eubacteria. ACKNOWLEDGEMENTS We thank Richard Herrm ann for Mycoplasma pneumoniae genomic DNA. This work was supported by grants from the Biotechnology and Biological Sciences Research Council, the Wellcome Trust, the Royal Society, and the Medical Research Council. M. J. D. was in receipt of a Prize Studentship from the Wellcome Trust. REFERENCES 1. Seigneur, M., Bidneko, V., Ehrlich, S.D & Michel, B. (1998) RuvAB a cts at a rrested replication forks. Cell 95 , 419–430. 2. McGlynn, P & Lloyd, R.G. (2000) Modulation of RNA poly- merase by ( p)p pGpp reveals a RecG-dependent mechanism for replicati on fork progre ssi on. Cell 101, 3 5–45. 3. Kowalczykowski, S .C. (2000) I nitiation of genetic recombination and recombination-dependent replication. Trends Biochem. Sci. 25, 156–165. 4. Singleton, M.R., Scaife, S & Wigley, D.B. (2001) Structural ana- lysis o f DNA replication fork reversal by R ecG. Cell 107, 79–89. 5. West, S.C. (1997) Processing of recombination i ntermediates by the RuvABC proteins. Annu.Rev.Genet.31, 213–244. 6. Sharples, G.J., Ingleston, S.M & Lloyd, R.G. (1999) Holliday junction processing in bacteria: i nsights from the evolutionary conservation of RuvABC, RecG, and RusA. J. Bacteriol. 181, 5543–5550. 7. Parsons, C.A., Stasiak, A., Bennett, R.J & West, S.C. ( 1995) Structure of a multisubunit complex that p ro motes DNA branch migration. Na tur e 374, 3 75–378. 8. Davies, A.A & West, S.C. (1998) Formation of RuvABC-Holliday junction complexes in vitro . Curr. Biol. 8, 725–727. 9. Zerbib, D.M., E ` zard, C., George, H & West, S.C. (1998) Co-ordinated actions of RuvABC in Holliday junction processing. J. Mol. B iol . 281, 621–630. 10. Eggleston, A.K & West, S.C. (2000) Cleavage of Holliday junc- tions by the Esch erichia co li RuvABC complex. J. Biol. Chem. 275, 26467–26476. 11. Nishino, T., Iwasaki, H., Kataoka, M., Ariyoshi, M., Fujita, T., Shinagawa, H & Morikawa, K. (2000) M odulation o f R uvB function by the mobile domain III of the Holliday junction recognition protein RuvA. J. Mol. Biol. 298, 407–416. 12. Ingleston, S.M., Sharples, G.J & Lloyd, R.G. (2000) The acidic pin of RuvA modulates Holliday junction binding and processing by the R uvABC resolvasome. EMB O J. 19, 6266–6274. 13. Rafferty, J.B., Sedelnikova, S.E., Hargreaves, D., Artymiuk, P.J., Baker, P.J., Sharples, G.J., Mahdi, A.A., Lloyd, R.G & Rice, D.W. (1996) C rystal structure of DNA recombination protein RuvA and a model for its b inding to the Holliday junction. Science 274, 415–421. 14. Nishino, T., Ariyoshi, M., Iwasaki, H., Shinagawa, H & Morikawa, K. (1998) Functional analyses of the domain structure in the Holliday junction binding protein RuvA. Structure 6, 11–21. 15. Hargreaves, D., Rice, D.W., Sedelnikova, S.E., A rtymiuk, P.J., Lloyd, R.G & Rafferty, J.B. (1998) Crystal structure of E. coli RuvA with bound DNA Holliday junction at 6 A ˚ resolution. Nat. Struct. Biol. 5, 441–446. 16. Ariyoshi, M., Nishin o, T., Iwasaki, H., Shinagawa, H & Morikawa, K. (2000) Crystal structure of the Holliday junction DNA i n complex with a single Ruv A tetramer. Proc. Natl Acad. Sci. USA 97 , 8257–8262. 17. Rafferty, J.B., Ingleston, S.M., Hargreaves, D., Artymiuk, P.J., Sharples, G.J., Lloyd, R.G & Rice, D .W. (1998) Structural s imi- larities between Escherichia coli RuvA and other DN A-binding proteins and a mutational analysis of its binding to the Holliday junction. J. Mol. Biol. 278, 105–116. 18. Roe, S.M., Barlow, T., Brown, T., Oram, M., Keeley, A., Tsaneva, I.R & Pearl, L.H. (1998) Crystal structure of an octameric RuvA-H olliday j unct ion c omplex. Mol. Cell. 2,361– 372. 19. Parsons, C.A., Tsaneva, I., Lloyd, R .G & West, S.C. (19 92) Interaction of E. coli RuvA and RuvB proteins with synthetic Holliday junctions. Proc. Natl Acad. Sci. USA 89, 5452–5456. 20. Lloyd, R.G & Sharples, G .J. (1993) Proc essing of rec ombination intermediates by the RecG and RuvAB proteins of Escherichia coli. Nucleic Acids Res. 21, 1719–1725. 21. Arenas-Licea, J., van Gool, A.J., Keeley, A.J., Davies, A., West, S.C & Tsaneva, I.R. (2000) F unctional interactions of Myco- bacterium l eprae RuvA with Escherichia coli RuvB and R uvC on Holliday junctions. J. Mol. Biol. 301, 839–850. 22. Yamada, K., Fukuoh, A., Iwasaki, H & Shinagawa, H. (1999) Novel properties of the Thermus thermophilus RuvB protein, which promotes branch-migration of Holliday j unctions. Mol. Gen. Genet. 261, 1001–1011. 23. Whitby, M.C., Bolt, E.L., Chan, S.N & Lloyd, R.G. (1996) Interactions between RuvA and RuvC a t Holliday junctions: inhibition of j unction cleavage and formation o f a RuvA–RuvC– DNA complex. J. Mol. B iol. 264, 878–890. 24. Lloyd, R.G & Sharples, G.J. (1993) Dissociation of synthetic Holliday junctions by E. coli RecG prote in. EMBO J. 12, 17–22. 25. Mandal, T .N., Mahdi, A.A., Sharples, G.J & L loyd, R.G. (1993) Resolution of Holliday intermediates in recombination and DNA repair: indirect suppression of ruvA, ruvB and ruvC mutations. J. Bacteriol. 17 5, 4325–4334. 26. Sharples, G.J., Chan, S.C., Mahdi, A.A., Whitby, M.C & Lloyd, R.G. (1994 ) Processing of intermediates in recombination and DNA repair: identific ation of a new endo nuclease that spe- cifically cleaves Holliday junctions. EMBO J. 13, 6133–6142. 27. Mahdi, A.A., Sharples, G.J., Mandal, T.N & Lloyd, R.G. (1996) Holliday junction resolvases encoded by homologous rusA genes in Escherichi a coli K-12 and phage 82. J. Mol. Biol. 257, 561–573. 28. Han, Y W., Iwasaki, H., Miyata, T., Mayanagi, K., Yamada, K., Morikawa, K & S hinagawa, H. (2001) A unique b-hairpin pro- truding from AAA + ATPase domain of RuvB motor protein is involved in the interaction with RuvA DNA recognition protein for branch migration of Holliday junctions. J. B iol. Chem. 276, 35024–35028. 29. Sargentini, N.J & Smith, K.C. (1989) Role of ruvAB genes in UV- and c-radiation and chemical mutagenesis in Escherichia coli. Mutation Res. 215, 115–129. 30. Himmelreich,R.,Hilbert,H.,Plagens,H.,Pirkl,E.,Li,B.C& Herrmann, R. (1996) Complete sequence analysis of the genome of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24, 4420–4449. 31. Sedelnikova, S.E., R afferty, J.B., Hargreaves, D., Mahdi, A.A., Lloyd, R.G & Rice, D .W. (1997) Crystallisation of E. coli RuvA gives insight s i nto t he symmetry of a Ho lliday junction/protein complex. Acta Crystallogr. D53, 122–124. 1532 R. G. Lloyd et al. (Eur. J. Biochem. 269) Ó FEBS 2002 32. Dunderdale, H.J., Sharples, G .J., Lloyd, R.G & West, S.C. (1994) Cloning, overexpression, purification and characterization of the Escherichia c oli RuvC Holliday junction resolvase. J. Biol. Chem. 269, 5187–5194. 33. Tsaneva, I.R., Illing, G.T., Lloyd, R.G & West, S.C. (1992) Purification and physical properties o f the RuvA and RuvB pro- teins of Escherichia coli. Mol. Gen. Genet. 235, 1–10. 34. Parsons, C.A., Kemper, B & West, S.C. (1990) Interaction of a four-way junction in DNA with T4 endonuclease VII. J. Biol. Chem. 265, 9285–9289. 35. Myszka, D.G., Jonsen, M.D & Graves, B.J. (1998) Equilibrium analysis of high affinity interactions using BIAcore. Anal. Biochem. 265, 326–330. Ó FEBS 2002 Mycoplasma RuvA protein (Eur. J. Biochem. 269) 1533 . Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae Stuart M. Ingleston 1 , Mark J. Dickman 2 , Jane A. Grasby 3 ,. structure on the DNA binding properties of RuvA we purified the Mycoplasma pneumoniae RuvA protein and compared its activity with that of EcRuvA. The protein