Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot

... revealed two separate reso-nances for Gal H-2, H-3 and H4 labeled A2 a ,A2 b, A3 a ,A3 b ,A4 a and A4 b, respectively. (Fig. 4A) . The 1D-NOESY of Gal H- 4a showed NOEs for Gal H- 2a, Gal H- 3a, Gal H-5 and ... J, Wang Y, Krueger WA, Madoff LC, Marti-rosian G, Boisot S, Goldmann DA, Kasper DL, Tziana-bos AO & Pier GB (1999) Isolation and chemicalcharacterization of a capsular polysaccharide antigenshared ... is complex and has a teichoic acid-like [-4) -a- d-Galp-(1–2)-(R)-Gro-(1-P-]nrepeatingunit with a b-d -fructofuranose branch at C-2 of Gal, a nonstoichiometric fructose branch at C-3 of Galand...

Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx

... (2005) The HS: 1 sero-strain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups. ... Sciences, National Research Council of Canada, Ottawa Ontario, Canada Campylobacter jejuni is one of the leading causes of human gastroenteritis and surpasses Salmonella, Shig-ella and Escherichia in ... Journal compilation ª 2006 FEBS 3989 The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate...

Báo cáo khoa học:The isolation and characterization of temperature-dependent ricin A chain molecules in Saccharomyces cerevisiae docx

... wereCP172 5¢-ATATTCCCCAAACAATACCC-3¢ and the anti-sense primer CP133 5¢-TTAAAACTGTGACGATGGTGGA-3¢ with the TAA termination anticodon shown inbold. Ampliﬁcation reactions were performed in a ﬁnal vol-ume ... Depurination in each lanewas calculated by relating the amount of any rRNA frag-ment released upon aniline treatment with the amount of 5.8S rRNA (directly proportional to the quantity of 25S rRNA) ... (ERAD). It appears likely thatRTA (and other toxins that reach the ER lumen) mayhi-jack components of the ERAD pathway to reach the cytosol, where a proportion of toxin can refold to a catalytically...

Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc

... between a- actinin and calpain 1 and locates binding motifs withinregions where the EF-hand domains of the protease and the cytoskeletal protein are concentrated. The behaviour of calpain 1 toward ... of the binding calpain. The topology of the interface with respectto the catalytic domain II [1] and the cleavage site in targetare also underlying.Two muscle a- actinin isoforms (ask and asm) ... shows that the C-terminal domain of a- actinin and each calpain subunit, 28 and 80 kDa, participates in the interaction. In particular, the autolysed calpain form(76/18) a ords a similar binding...

Báo cáo khoa học: The C-terminal region of the proprotein convertase 1⁄ 3 (PC1⁄ 3) exerts a bimodal regulation of the enzyme activity in vitro pdf

... the recombinant mPC1 ⁄ 3, the presence of the 87 kDa form in excess of the 66 ⁄ 71 kDa facilitatesisolation of the enzyme and helps in maintaining the enzymatic activity at a proper level. The ... acti-vation may thus be the consequence of an enhancedstability of the 66 kDa form. The CT-peptide is not cleaved by enzymaticallyactive PC1⁄3Another important feature of an enzymatic activator ... molecularmass of 12.5 kDa, which would favor cleavage of the C-terminal to the pair of Args occupying positions 627 and 628. This is an interesting observation because itsigniﬁes that the appearance...

Báo cáo khoa học: The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin 1 gene pot

... GATCGGATCCACTCCGCCACTCAGAAACTTAGERM N-terminal deletions140S: GATCGAATTCTCACCCACCCATCAGAATC200S: GATCGAATTCCCCCTGCAGATGCCAAAGATG304S: GATCGAATTCGAAGTGCCTAACTGC343S: GATCGAATTCGAGAGACTGGAAGGCAAAG349Rb: ... GATCCGGCCGTCATGTGAAGCCACCAT37-9S: GATCGCTAGCGTGTGATGAAGGCGGAGGCCTTGAATTCACG37- 9A GATCCGGCCGATCCAGTCAGTCGTCTATAC37-8S: GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC1676S: GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTGCHD3 ... GATCGAATTCTGGCCGAGAGCCACCAGCAC,1851S: GATCGAATTCTGGCGGGGAACAAGCCG,1861S: GATCGAATTCTGCACAAGGTTCTGAACCA,1872S: GATCGAATTCTGAGCGACATGAAGGCGGAC,1877S: GATCGAATTCTAGCGGACGTGACCCGCCTG,1891S: GATCGAATTCCCATCGCAGCCCGCCTTCAGATG,1904S:...

Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efﬁciency doc

... domain and the functionalrelationship of tandemly repeated domains in BPPs. We conjecture thatdual-domain BPPs have succeeded evolutionarily because they can increase the amount of available ... wasdetermined using the Bradford assay with BSA as the standard [28].Phytase activity assayPhytase activity was determined by measuring the amount of phosphate released from InsP6using a modified ferroussulfate ... 1. The higherspecific activity kcat and Vmaxvalues and lower Kmvalue of PhyH suggests that PhyH is more catalytically efficient and has a greater affinity for InsP6than PhyH-DII.Substrate...

Tài liệu Báo cáo khoa học: The thioredoxin-independent isoform of chloroplastic glyceraldehyde-3-phosphate dehydrogenase is selectively regulated by glutathionylation docx

... damage of chloroplastic A 4-GAPDH.ResultsInactivation of A 4-GAPDH by GSSG and otheroxidants, and protection by substrate and cofactorsIncubation of recombinant Arabidopsis A 4-GAPDH with ... Arabidopsis A 4-GAPDH The sequence encoding the putative mature form of the A. thaliana plastidial A 4-GAPDH isoform (GapA-1 cDNAAt3g26650 provided by TAIR, Stanford, CA, USA) wasampliﬁed by PCR using the following ... JP & Branlant G(1998) Comparative study of the catalytic domain of phosphorylating glyceraldehyde-3-phosphate dehydro-genases from bacteria and archaea via essential cysteineprobes and...

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

... hexameric state (U6) and monomeric state (6 U). Figure 4A shows that the native form of Hfq has an apparent molecular mass of 50 ± 10 kDa, while the unfolded state of Hfq has anaverage apparent ... betweenProteobacteria, Firmicutes, Thermotogales and Aquiﬁcales. On the contrary, the C-terminal fragments are variable in length and amino acidcomposition. The position of Helix H1 and of the ﬁve b-strands ... suggests a conformational change at the interface between the subunits (Fig. 2C, bottom-right), thathave been described as the strand b4ofchainBandthestrand b5 of chain A in the crystal structure...

Tài liệu Báo cáo khoa học: "The grapho-phonological system of written French: Statistical analysis and empirical validation" pdf

... grapheme-phoneme mappings and hence, that they are more consistent with a parallel distributed approach than with the abstract rules hypothesis. . Statistical analysis of grapho- phonological correspondences ... both the immediate naming and the delayed naming task. By-subjects and by-items (Ft and F2, respectively) analyses of variance were performed with grapheme frequency and grapheme entropy as within-subject ... impose a substantial restatement of the theory, because it violates the core assumption of the approach, namely, that language users induce all- or-none rules from the language to which they are...

Xem thêm