The C-terminal region of CHD3/ZFH interacts with the CIDD region of the Ets transcription factor ERM and represses transcription of the human presenilin gene Martine Pastorcic1 and Hriday K Das1,2 Department of Pharmacology & Neuroscience, University of North Texas Health Science Center at Fort Worth, TX, USA Department of Molecular Biology & Immunology, and Institute of Cancer Research, University of North Texas Health Science Center at Fort Worth, TX, USA Keywords CHD3; ERM; presenilin-1; transcription; yeast-two-hybrid Correspondence H.K Das, Department of Pharmacology & Neuroscience, and Institute of Cancer Research, University of North Texas Health Science Center at Fort Worth, 3500 Camp Bowie Boulevard, Fort Worth, TX 76107, USA Fax: +1 817 735 2091 Tel: +1 817 735 5448 E-mail: hdas@hsc.unt.edu (Received August 2006, revised January 2007, accepted January 2007) doi:10.1111/j.1742-4658.2007.05684.x Presenilins are required for the function of c-secretase: a multiprotein complex implicated in the development of Alzheimer’s disease (AD) We analyzed expression of the presenilin (PS1) gene We show that ERM recognizes avian erythroblastosis virus E26 oncogene homolog (Ets) motifs on the PS1 promoter located at )10, +90, +129 and +165, and activates PS1 transcription with promoter fragments containing or not the )10 Ets site Using yeast two-hybrid selection we identified interactions between the chromatin remodeling factor CHD3 ⁄ ZFH and the C-terminal 415 amino acids of ERM used as bait Clones contained the C-terminal region of CHD3 starting from amino acid 1676 This C-terminal fragment (amino acids 1676–2000) repressed transcription of the PS1 gene in transfection assays and PS1 protein expression from the endogenous gene in SH-SY5Y cells In cells transfected with both CHD3 and ERM, activation of PS1 transcription by ERM was eliminated with increasing levels of CHD3 Progressive N-terminal deletions of CHD3 fragment (amino acids 1676–2000) indicated that sequences crucial for repression of PS1 and interactions with ERM in yeast two-hybrid assays are located between amino acids 1862 and 1877 This was correlated by the effect of progressive C-terminal deletions of CHD3, which indicated that sequences required for repression of PS1 lie between amino acids 1955 and 1877 Similarly, deletion to amino acid 1889 eliminated binding in yeast two-hybrid assays Testing various shorter fragments of ERM as bait indicated that the region essential for binding CHD3 ⁄ ZFH is within the amino acid region 96–349, which contains the central inhibitory DNA-binding domain (CIDD) of ERM N-Terminal deletions of ERM showed that residues between amino acids 200 and 343 are required for binding to CHD3 (1676–2000) and C-terminal deletions of ERM indicated that amino acids 279–299 are also required Furthermore, data from chromatin immunoprecipitation (ChIP) indicate that CHD3 ⁄ ZFH interacts with the PS1 promoter in vivo Abbreviations 3-AT, 3-amino-1,2,4-triazole; AD, Alzheimer’s disease; APP, amyloid precursor protein; CAT, chloramphenicol acetyl transferase; CHD3, chromodomain helicase DNA-binding protein 3; ChIP, chromatin immunoprecipitation; CIDD, central inhibitory DNA binding domain; ER81 (ETV1), Ets-related protein 81 or Ets translocation variant 1; ERM, Ets-related molecule or ETV5-Ets translocation variant 5; Ets, avian erythroblastosis virus E26 oncogene homolog; HDAC, histone deacetylase complex; PEA3 (or E1AF, ETV4), polyoma enhancer A3; PS1, presenilin 1; ZFH, zinc finger helicase 1434 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das Presenilins (PS1 and PS2) are highly homologous multipass transmembrane proteins [1,2] PS1 mutations have been linked to early-onset familial Alzheimer’s disease (AD) [3,4] Presenilins are required for the function of c-secretase, a multiprotein complex that has also been implicated in the development of AD [5–8] They may act as a catalyst or be involved in the structure and metabolism of the complex itself c-Secretase has been implicated in the development of AD because of its role in cleavage of the amyloid precursor protein (APP) and the production of Ab peptide, which is central to the pathogenesis of AD [9] Similarly, processing of the Notch receptor protein, which controls signaling and cell–cell communication has indicated a role for presenilin in development [10] Presenilin and c-secretase also appear to cleave a variety of type transmembrane proteins which all release intracellular fragments with the ability to interact with transcription coactivators [11,12] They include CD44, a ubiquitous cell-adhesion protein [13], and neuronal cadherin (N-cadherin) [14] Hence it appears that presenilins may affect the expression of many genes through intramembrane proteolysis [12] Control of the level of presenilins and its coordination with other components of the c-secretase complex are likely to be tightly regulated and we studied the transcriptional control of the PS1 gene We identified DNA sequences required for expression of the human PS1 gene A promoter region has been mapped in SK-N-SH cells and includes sequences from )118 to +178 flanking the major initiation site (+1) However, we have shown that the promoter is utilized in alternative modes in SK-N-SH cells and its SH-SY5Y subclone [15] The )10 Ets site controls 80% of transcription in SK-N-SH cells, whereas by itself it plays only a minor role in SH-SY5Y cells Conversely, the Ets element at +90 controls 70% of transcription in SH-SY5Y cells, whereas it affects transcription by < 50% in SK-N-SH cells [15] However, in both cell types, mutations at both the )10 and +90 Ets sites substantially eliminate transcription activity, indicating the crucial importance of these two Ets motifs [15] In addition to controlling the level of gene expression, Ets factors may direct the choice of the promoter elements in play, and therefore, determine the selective combination of transcription factors involved and the regulatory pathways modulating transcription We have identified several Ets factors that specifically recognize the )10 Ets motif using yeast one-hybrid selection including avian erythroblastosis virus E26 oncogene homolog (Ets2), Ets-like gene (Elk1), Ets translocation variant (ER81) and Etsrelated molecule (ERM) [15–17] The ets genes encode Regulation of the presenilin gene a family of transcription factors and most are transcriptional activators [18,19] They share a conserved 85-amino acid motif, the ETS domain, which recognizes a nine-nucleotide DNA sequence with the central consensus 5¢-GGAA ⁄ T-3 (Fig 1A) [18,20] Based on the sequence homology of the ETS domain, and the conservation of other functional domains, a phylogenic tree of the ETS gene family has been derived [20] identifying 13 subgroups ERM belongs to the PEA3 subgroup, which also includes ER81 (or ETV1) and PEA3 (or ETV4) [20–23] They share three conserved domains The most highly conserved ETS sequence, the Ets domain, is required for specific DNA binding to the consensus motif [18,24,25] Two transactivating domains, at the N-terminus and the C-terminus are less conserved within the Ets family [26–28] However the N-terminus is highly conserved among ERM, ER81 and PEA3, and has been shown to interact with TAFII60 [27] The C-terminal transactivation domain functions in synergy with the N-terminal activation domain but is not functionally equivalent [26,28] The central inhibitory domain (CIDD) of ERM shows significantly less conservation with the other two PEA3 members [26] Both the C-terminal and central domain modulate DNA binding by the Ets domain and contain an inhibitory function [18] We chose to analyze the role of ERM because little is known about its mode of action and particularly the transcription factors with which it interacts ERM recognizes specifically Ets motifs located at )10 as well as downstream at +90, +129 and +165 on the PS1 promoter and it activates PS1 transcription with promoter fragments containing or not the Ets motif at )10 In this report we have identified a new interaction between ERM and CHD3 ⁄ ZFH using yeast twohybrid selection, and we show that this interaction occurs between the C-terminal amino acid residues 1862–1877 of CHD3 and the CIDD domain of ERM Results ERM interacts with CHD3 To identify proteins interacting with ERM we used the C-terminal region (415 amino acid) of ERM, excluding the first 95 amino acids, as a bait (Fig 1A) to screen a human brain cDNA library in pACT2 [17,26] using a yeast two-hybrid selection assay The excluded N-terminus includes a transcription activation domain highly conserved among ERM, ER81 and PEA3, which has been shown to interact with TAFII60 [27] The bait included the CIDD, the Ets domain and the C-terminal domain (Fig 1A) [18] The Ets domain is FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1435 Regulation of the presenilin gene M Pastorcic and H.K Das A Fig Interactions of ERM protein domains with CHD3 (A) The domains conserved within the PEA3 family are boxed, including the N-terminal a-helical acidic domain contained within the first 72 amino acids, the Ets domain, the CIDD and the C-terminal domain The fragment of cDNA included in the bait used for two-hybrid screening of the brain cDNA library included amino acids 96–510 at the C-terminus Shorter ERM fragments were also tested as bait in yeast two-hybrid assays and are indicated by boxes below Growth was scored at days Black boxes indicate activity similar to the larger bait fragment White boxes indicate fragments with no or little binding activity at mM 3-AT Striped and gray boxes show an intermediate level of binding activity Gray box had 50% growth at 30 and 60 mM 3-AT compared with the larger construct Striped box showed no growth at 60 mM 3-AT and 25% growth on 30 mM 3-AT (B) The growth of yeast patches from AH109 transformed with the CHD3 C-terminal fragment including amino acids 1676–2000 together with the various ERM bait fragments indicated on the left was scored at days Growth on medium excluding leucine, tryptophan and histidine and including increasing concentration of 3-AT from to 60 mM was compared with growth on medium lacking leucine and tryptophan (C) (C) Similarly the growth of AH109 cotransformed with CHD3 and either N-terminal deletions (left) or C-terminal deletions (right) of the ERM fragment spanning amino acids 96–349 was tested in the presence of increasing amounts of 3-AT (0–60 mM; upper) The end point of each deletion is indicated alongside B C highly conserved among the Ets family and is required for specific DNA binding to the consensus motif [18,24,25] The C-terminal domain includes a transactivation domain functioning in synergy with the N-ter1436 minal activation domain but it is not equivalent [26,28] Both the C-terminal domain modulate DNA binding by the and contain an inhibitory function functionally and central Ets domain The ERM FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das fragment was cloned inframe with the GAL4BD (amino acids 1–147 of GAL4 protein) Expression of the GAL4–HIS3 reporter gene is leaky in AH109: a low level of expression occurs in the absence of GAL4 activation 3-Amino-1,2,4-triazole (3-AT; an inhibitor of histidine biogenesis) is used to quench background growth on His minus medium and the minimum level of 3-AT required varies with the bait Library screening identified two clones encoding the C-terminal portion of the chromodomain helicase–DNA-binding protein (CHD3) or zinc finger helicase (ZFH), conferring growth on 3-AT at concentrations as high as 60 mm by days after plating CHD3 is expressed in several forms derived by alternative splicing [29–31] (Figs and 3) and ZFH is one such form of CHD3 The two clones selected using yeast two-hybrid screening contained sequences downstream of amino acid 1676, and were identical to the CHD3 variants 1, and over their C-terminal protein sequence (Fig 3) Identification of the ERM region interacting with CHD3 using yeast two-hybrid analysis We constructed a series of shorter bait fragments to identify the region required for interaction of ERM with CHD3 (Fig 1A,B) We tested CIDD + Ets, Ets + C-terminus, Ets, CIDD, or C-terminus only 3-AT (5 mm) was used to screen the library and was sufficient to quench background growth on His-minus medium for all the baits in the 6-day timeframe observed CIDD binding activity was identical to the larger fragment including amino acids C-terminal to residue 96 No growth was observed at days on Hismedium containing as little as mm 3-AT with baits including C-terminal domain alone or a fragment including Ets and C-terminal domains together The Ets domain by itself conferred growth at and 30 mm but showed no colonies at 60 mm Hence, the Ets domain is able to bind CHD3 independently but the C-terminal domain appears to modulate this interaction A more precise location of ERM sequences required to bind CHD3 (1676–2000) was derived from a set of N- and C-terminal deletions of the ERM fragment spanning amino acids 96–349 with CHD3 (Fig 1C) N-Terminal deletions to residue 304 totally eliminated growth at 60 mm 3-AT, but allowed residual growth at 30 mm at later time points (6–8 days) Deletions to residue 343 eliminated all growth on 30 mm 3-AT C-Terminal deletion to residue 279 eliminated growth at 30 mm 3-AT, indicating that amino acids 299–279 are also required Both series indicate the importance of the interval 279–299 However, sequences from 304 to 343 are also important Hence Regulation of the presenilin gene mutating both regions may be required to eliminate binding to CHD3 CHD3 represses the transcription of PS1 in SH-SY5Y neuronal cells We tested the effects of pC1.CHD3 on expression of the PS1 gene in SH-SY5Y cells We compared the action of the C-terminal fragment (amino acids 1676– 2000) with larger fragments including amino acids 295–1717, 1005–2000 and 1327–2000 The most significant activity was observed with the C-terminal fragment (1676–2000), which represses transcription of PS1 in transient infection assays by nearly 10-fold (Fig 3) These results suggest that in a particular cellular context the interactions of full-length CHD3 with specific proteins may result in conformation changes that enable the same protein interactions that occur more readily with the isolated C-terminal domain Because ERM acts as a transactivator of PS1, we asked whether CHD3 would alter the activation of transcription of PS1 by ERM (Fig 4) In cotransfections of PS1CAT reporter with pC1.ERM, increasing amounts of pC1.CHD3 appeared to eliminate the activation of PS1 by ERM We have previously shown that ERM activates PS1 transcription through sequences upstream as well as downstream of the major transcription start site in SH-SY5Y cells [15] Hence, we compared the effect of CHD3 on the two promoter fragments: )118,+178, which contains sequences flanking the transcription start site, and +6,+178, which contains only downstream sequences (Fig 5A) Both promoter sequences conferred a significant inhibition by pC1.CHD3 (Fig 5A), which is consistent with the presence of ERM-binding sites upstream as well as downstream of the transcription start site We also examined the effects of point mutations within several of the Ets sites present within the PS1 promoter (Fig 5B) None of the single mutants at +20,+90 or double mutants ()10,+90) ()10,+65) (+65,+129) (+90,+129) appears to affect repression by CHD3, suggesting a redundancy between Ets sites Delineation of the CHD3 domain(s) required for the repression of PS1 transcription and interaction with ERM by deletion mapping Different N-terminal deletions of CHD3 were cloned into pCMV-Tag2 vector to generate pCMV-Tag2ỈCHD3 expression constructs These pCMV-Tag2ỈCHD3 constructs were transiently cotransfected into SH-SY5Y cells We examined the effects of N-terminal deletions of CHD3 on the transcription of the ()118,+178) PS1CAT FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1437 Regulation of the presenilin gene M Pastorcic and H.K Das Fig CHD3 proteins The structure of CHD3 and ZFH forms of CHD3 proteins derived by alternative splicing are summarized Black shadows with white letters indicate the sequences present in ZFH, but absent in CHD3: a 34 amino acid insertion at 1642, and a 34 amino acid terminal region substituted by 12 heterologous amino acids in CHD3 (boxed) In the functional assays reported here we have considered the ZFH form of the gene The position of helicase domains (I–VI) is underlined [29] The histidine and cysteine residues involved in putative zinc fingers are marked by stars An acidic region at amino acid 431 and the nuclear localization signals at 691 and 954 are shadowed in gray The end-points of the N-terminal deletions tested in binding or transcription assays are marked by arrowheads and gray letters The two clones selected by yeast two-hybrid screening contained the 325 amino acid C-terminal fragment of CHD3: amino acids 1676–2000 reporter (Fig 6A) Progressive N-terminal deletions from amino acid 1676 towards amino acid 2000 indicated that crucial amino acid residues for repression activity of CHD3 are present between 1810 and 1818 as well as 1862 and 1877, because deletion of each region reduced the repression activity by  50% Finally, the repression activity is completely eliminated with deletion to 1877 Similar to the effects on transcription, the interactions with ERM tested in yeast two-hybrid assays (Fig 6B) were unaffected by N-terminal deletions from 1676 to 1810 (end points at 1801 and 1810 not shown) 1438 Unlike the effects on PS1 transcription (Fig 6A), further deletions with end points at amino acids 1810, 1818, 1830, 839, 1851 and 1861 did not affect interactions with ERM (data not shown) Deletion from amino acids 1862–1871 (N-terminal end point at amino acid 1872) drastically reduced 3-AT resistance: < 10% growth was observed even at mm 3-AT in deletions to 1872 (Fig 6B) No further reduction was observed with deletions to 1877, 1891, 1904, 1914 and 1924 (data not shown) Only deletion reaching position 1943 totally eliminated any growth down to the level observed in FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das Regulation of the presenilin gene Fig Inhibition of PS1 transcription by CHD3 SH-SY5Y cells were transiently transfected using the calcium phosphate precipitation method with lg of ()118, +178) PS1CAT reporter together with lg of either pC1 vector or pC1.CHD3 Various fragments of CHD3 protein expressed from pC1.CHD3 include amino acids 295–1717, 1005–2000, 1327–2000 and 1676–2000 The relationship of these CHD3 protein fragments to the different variants reported for CHD3 is summarized on top Base pair positions are according to gi#2645432 for CHD3 and gi#3298561 for ZFH Promoter activity in the presence of each construct is indicated laterally, with the activity in the presence of the empty pC1 vector arbitrarily set as 100% CAT activity in different samples was standardized using the amount of protein present in the cellular extracts as an internal control Each experiment was repeated three times, with at least triplicate tests of each construct combination Fig CHD3 antagonizes PS1 activation by ERM SH-SY5Y cells were transiently transfected using the calcium phosphate precipitation method with lg of ()118, +178) PS1CAT reporter together with lg of pC1 vector or pC1.ERM in the presence of 0, or lg pC1.CHD3 pC1.ERM expresses the full-length ERM protein pC1.CHD3 contains the CHD3 fragment expressing amino acids 1676–2000 Promoter activity in different samples was standardized using the amount of protein present in the cellular extracts as an internal control Each experiment was repeated three times, with at the minimum triplicate tests of each construct combination transformants containing the empty vector (Fig 6B) Hence the binding interface appears to be located in the C-terminal of CHD3, after amino acid 1861 and crucial sequences for CHD3–ERM interaction are located between 1862 and 1877 However, in both in transcription and in yeast two-hybrid assays, none of the single amino acid mutations in this interval had any effect (data not shown) Although they are not identical, the results from the transfection assays in neuroblastoma cells and from the yeast assays both indicate the presence of a crucial ERM-binding domain of CHD3 located at the C-terminal from amino acid residue 1862 Further delineation was obtained with C-terminal deletions (Fig 7A) Deletion to 1877 eliminated repression activity (Fig 7A), which is consistent with the N-terminal deletions Deletions to 1902 had only a minor effect (Fig 7A) Hence essential sequences appear to be located between residues 1902 and 1877 Similarly, binding measured by yeast two-hybrid assay delineated important sequences between 1955 and 1902 (Fig 7B) FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1439 Regulation of the presenilin gene M Pastorcic and H.K Das A B Fig Inhibition of PS1 transcription by CHD3 (A) SH-SY5Y cells were transiently transfected using the calcium phosphate precipitation method with lg of ()118, +178) PS1CAT (circles) or (+ 6, +178) PS1CAT (triangles) reporter together with either pC1 vector or increasing amounts of pC1.CHD3 pC1.CHD3 contains the CHD3 fragment expressing amino acids between 1676 and 2000 The total amount of (pC1.CHD3 + pC1) was kept constant at lg Promoter activity in different samples was standardized using the amount of protein present in the cellular extracts as an internal control (B) Effect of PS1 promoter mutations at Ets elements on the inhibition of transcription by CHD3 SH-SY5Y cells were transfected with lg of ()118, +178) PS1CAT wild-type (wt) or containing point mutations at the sites indicated in the presence of lg of pC1.CHD3 (1676–200) or the empty pC1 expression vector Promoter activity in different samples was standardized with the amount of protein present in cell extracts Each experiment was repeated three times, with a minimum of three tests for each construct combination Interaction of CHD3 with the PS1 promoter in vivo We sought to document more directly the role of CHD3 in the regulation of PS1 gene in vivo We first 1440 Fig Effect of N-terminal deletions of CHD3 on the inhibition of transcription by CHD3 and on the binding of CHD3 with ERM (A) Effect of N-terminal deletions on the inhibition of transcription by CHD3 SH-SY5Y cells were transiently transfected using the calcium phosphate precipitation method with lg of the ()118, +178) PS1CAT reporter together with lg of either pCMV-Tag2 or pCMV-Tag2ỈCHD3 pCMV-Tag2ỈCHD3 expresses various N-terminal fragments of CHD3 with the indicated N-terminal end-point (from position 1676–1943) The C-terminal end point of the above N-terminal deletions of CHD3 expressed by pCMV-Tag2 CHD3 is at amino acid 2000 Promoter activity in different samples was standardized using the amount of protein present in the cellular extracts as an internal control Each experiment was repeated three times, with a minimum of n ¼ for each data point Values that differ significantly from the level of inhibition observed in cotransfections with the C-terminal amino acids 1676–2000 of CHD3 (1676) with P < 0.05 by t-test ⁄ ANOVA are indicated (*) (B) Identification of CHD3 domains interacting with ERM by yeast two-hybrid assay The same N-terminal deletions of CHD3 mentioned in (A) were introduced into pACT2 to generate various pACT2.CHD3 construct which were introduced into AH109 pretransformed with the Gal4BD–ERM fusion bait (amino acids 96–510) The ability of the mutants to promote growth on SD medium lacking tryptophan, leucine or histidine and including 15 mM of 3-AT was scored after days Patch L represents transformants with pACT2.CHD3 which expresses CHD3 fragment containing amino acids 1676–2000 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das A B Fig Effect of C-terminal deletions of CHD3 on the inhibition of transcription by CHD3 and its binding to ERM (A) Effects of C-terminal deletions on the inhibition transcription by CHD3 SH-SY5Y cells were transiently transfected by calcium phosphate precipitation method with lg of the ()118, +178) PS1CAT reporter together with lg of either pCMV-Tag2 vector or pCMVTag2ỈCHD3 pCMV-Tag2ỈCHD3 expresses various C-terminal fragments of CHD3 with the indicated C-terminal end-point (from position 2000–1790) The N-terminal end point of the above C-terminal deletions of CHD3 expressed by pCMV-Tag2ỈCHD3 is at amino acid 1676 Promoter activity in different samples was standardized using the amount of protein present in the cellular extracts as an internal control Each experiment was repeated three times, with a minimum of n ¼ for each data point Values that differ significantly from the level of inhibition observed in cotransfectoins with the C-terminal amino acids 1676–2000 of CHD3 (2000) with P < 0.05 by t-test ⁄ ANOVA are indicated (*) (B) Effect of C-terminal deletions of CHD3 on its interaction with ERM in yeast two-hybrid assays A subset of the same C-terminal deletions of CHD3 were introduced into pACT2 and transformed into AH109 pretransformed with the Gal4BD–ERM fusion bait (amino acids 96–510) The deletion end points to 1955, 1902 and 1889 are indicated on the right The ability of the mutants to promote growth on SD medium lacking tryptophan, leucine or histidine and including 0, 5, 30 or 60 mM of 3-AT was scored after days Regulation of the presenilin gene examined the interactions of the endogenous CHD3 and ERM produced in SH-SY5Y cells with the cellular chromatin (Fig 8A) We tested whether interactions of CHD3 or ERM and the PS1 promoter area around the main transcription start site (+1) could be detected using chromatin immunoprecipitation assays (ChIPs) Cross-linked DNA–protein complexes were immunoprecipitated with antibodies to CHD3 or ERM, and the DNA was analyzed for the presence of PS1 promoter sequences Although we detected interactions with ERM (lane 2) we did not detect any interaction of the PS1 promoter with endogenous CHD3 (lane 1) An alternative ChIP assay was carried out using fusion proteins including the Flag epitope and CHD3 inserted downstream in the pCMV-Tag2 vector transfected with high frequency into SH-SY5Y cells using lipofectamine Cross-linked DNA–protein complexes were immunoprecipitated with anti-Flag2 serum The DNA in the complexes was then analyzed by PCR for the presence of the PS1 promoter (Fig 8B) Promoter sequences from a gene unrelated to PS1 and not containing Ets elements (IRL) not appear to be enriched in cells transfected with CHD3 (lanes and 2) as compared to cells transfected with pCMV-Tag2 vector alone (lane 3) However the PS1 promoter sequences flanking the PS1 transcription initiation site are more enriched in cells transfected with the C-terminal fragment of CHD3 spanning residues 1676–2000 (lane 2) than CHD3 fragment spanning residues 1676–1877 (lane 1), a poor repressor of the PS1 gene (Fig 6A) Hence it appears that CHD3 (1676–2000) interacts somehow with the area around the PS1 promoter in vivo CHD3 inhibits PS1 protein levels in SH-SY5Y cells Western blot analysis of total protein from SH-SY5Y cells transiently transfected with pCMV-Tag2 or pCMV-Tag2ỈCHD3 showed that the CHD3 gene fragment encoding amino acids 1676–2000 decreased the amount of C-teminal fragment of PS1 protein ( 20 kDa PS1CTF) by  60%, whereas transfection of the CHD3 gene fragment encoding amino acids 1741–2000 decreased PS1 protein level by  75% Hence increasing the level of CHD3 in neuroblastoma cells reduced the amount of PS1 protein produced by the endogenous gene These results suggest that CHD3 may indeed reduce the level of PS1 in vivo and may affect the level of PS1 ⁄ c-secretase activity Discussion We have identified interaction(s) of the CIDD domain of ERM with the C-terminal domain of CHD3 The FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1441 Regulation of the presenilin gene M Pastorcic and H.K Das Fig CHD3 interaction with the PS1 promoter (A) Interaction of the endogenous CHD3 produced in SH-SY5Y cells with the cellular chromatin Exponentially growing SH-SY5Y were cross-linked with 1% formaldehyde, lyzed and chromatin was sheared The nuclear protein–DNA complexes were immunoprecipitated by incubation with antibodies to CHD3 (aCHD3: sc-11378X; Santa Cruz Biotechnology) and ERM (aERM1: sc-1955X or aERM2: sc22807X) Control serum was added in (C) The DNA precipitated in the complexes was analyzed by PCR to detect PS1 promoter sequences from )25 to +66 as well as +45 to +100 No DNA was added to the PCR reaction in lane Unrelated control DNA sequences (IRL: monoamine oxydase B gene) were tested as internal standard (B) Interaction of the C-terminal fragment of CHD3 (amino acids 1676– 2000) with the promoter of the endogenous PS1 gene SH-SY5Y cells were transiently transfected by lipofectamine with lg of either pCMV-Tag2 vector [C] or pCMV-Tag2–CHD3 expressing the Flag Tag2–CHD3 fusion protein including residues 1676–1877 (1877) or 1676–2000 (1676) Forty hours after transfection cells were cross-linked with 1% formaldehyde, lyzed and chromatin was sheared Nuclear protein–DNA complexes were immunoprecipitated by incubation with anti-Flag M2 agarose beads DNA in the cross-linked complexes was analyzed by PCR to detect PS1 promoter sequences (91 bp) from )25 to +66 and (55 bp) from +45 to +100 (Table 1) Unrelated control DNA sequences (IRL) without Ets-binding site were tested as internal standard A B C-terminal amino acid residues between 1862 and 1877 (Fig 6B) of CHD3 appears to be crucial for interaction with the CIDD domain of ERM We have also detected interactions of CHD3 with the Ets domain of ERM Both the interactions with CIDD and Ets appear to be modulated by adjacent domains Binding to CIDD is stronger than CIDD + Ets, and binding to Ets alone is stronger than Ets + C-terminal The effect of C-terminal deletions of ERM-delineated sequences required for interaction with CHD3 between residues 279 and 299, and this is consistent with the effects of N-terminal deletions of ERM However N-terminal deletions of ERM indicate that the residues 304–343 region may also be important in the interactions with CHD3 1442 Fig Expression of CHD3 inhibits PS1 protein expression SH-SY5Y cells were transiently transfected by lipofectamine with lg of either pCMV-Tag2 vector [C] or pCMV-Tag2-CHD3 expressing the Flag Tag2-CHD3 fusion protein A, a typical Western blot shows the expression of PS1, FLAG-tagged-CHD3, and GAPDH protein levels (C) 1676, and 1741 represent western blot analysis with protein extracts from cells transfected with pCMV-Tag2, pCMV-Tag2–CHD3 (amino acids 1676–2000), and pCMV-Tag2– CHD3 (amino acids 1741–2000), respectively Arrows indicate the position of the FLAG-CHD3 fusion protein (amino acids 1676–2000) on the left, and FLAG-CHD3 (amino acids 1741–2000) on the right A protein band unrelated to CHD3 appears in all the samples The nature of this nonspecific protein band is unknown Blots were developed by chemiluminescence and protein gel bands were quantified using SCION IMAGE software (n ¼ 4) (B) Bar graphs show relative expression of PS1 protein ( 20 kDa PS1CTF) normalized to the expression of GAPDH Data was analyzed by paired t-test ⁄ ANOVA and (*) indicates that protein level in1676 and 1741 samples were different from the control (C) with P < 0.05 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das The tertiary structure of ERM is not entirely known [32] The DNA-binding Ets domain adopts a winged helix–turn–helix form [24,25] DNA binding is inhibited by the CIDD at amino acids 203–290 and the Cterminus at positions 468–510, which appear to act in synergy [26–28,33,34] A shorter domain at 291–355 also plays an inhibitory role The mode of inhibition of DNA binding is unknown Furthermore, both CIDD and the C-terminus contain transactivation activity and are able to synergize, but are not functionally equivalent [22,27,28,33,34] The CIDD and C-terminus appear mostly devoid of identifiable tertiary structure except for a short a helix in CIDD at position 216 [32] Post-translational modifications have been identified in the CIDD that may potentially affect the structure and function of ERM through its ability to inhibit DNA binding or to interact with other proteins Phosphorylation sites at amino acids 223 and 248 are conserved with ER81 where they appear to affect transactivation [35,36] Sumoylation sites are present in ERM at residues 89, 263, 293 and 350 [37] Modification at these sites does not appear to affect DNA binding but does decrease transactivation by ERM [37] Transactivation of the human Ets-responsive ICAM-1 promoter by ERM was increased by mutants eliminating sumoylation at all three sites 263–293–350 together in COS-7 cells [37] It is interesting to note that although the activation of the synthetic reporter containing three E74 Ets-binding sites inserted upstream from the thymidine kinase promoter by ERM requires modification such as phosphorylation at the serine residue 367 [38] that simultaneously decreases DNA binding, it can be activated by the triple mutant eliminating sumoylation at sites 263–293–350 together [37] The mechanism of action of sumoylation of ERM is unknown and could potentially involve the regulation of interactions with cofactors We have identified an interaction between CHD3 and the CIDD region of ERM CHD3 (ZFH) is a member of the chromodomain family of proteins and includes chromo (chromatin organization modifier) domains and helicase ⁄ ATPase domains (Fig 2) It is a component of a histone deacetylase complex which participates in the remodeling of chromatin by deacetylating histones Chromatin remodeling and the unwinding activity of helicases are required for many aspects of DNA metabolism: replication, recombination, chromatin packaging and transcription Chromatin-remodeling factors have been implicated in the repression of transcription [29,30] CHD3 is widely expressed as three different isoforms (variants 1, and 3) derived by alternative splicing [29,30] It is interesting to note that CHD3 has been Regulation of the presenilin gene found to interact with SUMO-1 [39], indeed a potential SUMO-1 motif ‘VKKE’ is located at position 1970 within the C-terminal region required for repression of PS1 (Fig 6A) However, C-terminal deletion mapping indicates that it is not required for repression in our system (Fig 7A) Interactions of CHD3 with SUMO-1 were detected using yeast two-hybrid screening for proteins interacting with the p73 protein, a p53-related factor often mutated in neuroblastoma [40] However, yeast two-hybrid assays also showed interactions between SUMO-1 and p53 and p73 [39] Hence it is possible that CHD3 is implicated in complexes with p73 and p53 through interaction with SUMO-1 (and in yeast the SUMO-1 equivalent Smt3p) and that such interactions participate in the repression of transcription by p53 and p73 It is possible that we are observing a similar case and that our yeast two-hybrid selection implicated a SUMO-1 yeast protein intermediate An increasing number of reports have implicated CHD3 in the repression of transcription by its participation in histone deacetylase complexes (HDAC) [41–43], which have been implicated in the repression of gene activity [41,44] In particular, repression by p53 protein appears to involve HDAC complexes in which p53 interacts with HDAC indirectly via the corepressor mSin3a It may be worth noting that the transcription of PS1 is repressed by p53 and the cofactor p300 [45] It is possible that CHD3 participates in the repression of PS1 in vivo via mechanisms including some of the aspects outlined above Such mechanisms may function to antagonize the induction of apoptosis by p53 Several transcriptional repressors have implicated CHD3 repression [42,43,46–50] Interestingly, several of these corepressors also interact with the C-terminal regions of CHD3 downstream of residue 1676 [46] or the conserved regions of CHD4 and dMi2 [50] Models proposed to explain the repression of transcription involve a transcriptional repressor functioning as a hinge between the HDAC complex and the factors binding to the gene promoter DNA [50] In the case described here we may be observing a direct interaction between a component of HDAC and the transcription factor ERM However, we were not able to show this interaction in vitro using a pull-down assay, although CHD3 was found to be associated with the PS1 promoter region using chromatin immunoprecipitation It may be due to lack of stability of the complex because ChIP assays involve cross-linked proteins We cannot rule out that the interaction was indirect and implicated a protein such as the yeast homolog of SUMO-1 Two homologous proteins, Ki-1 ⁄ 57 and CGI-55, have recently been shown to interact with the FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1443 Regulation of the presenilin gene M Pastorcic and H.K Das C-terminal region of CHD3 [51] Ki-1 ⁄ 57 was identified as the phosphoprotein antigen recognized by the first antibody to specifically detect malignant Hodgkin and Sternberg–Reed cells in Hodgkin lymphoma CGI55 is a homologous protein Sequencing of the CHD3 clones selected by yeast two-hybrid indicates that all the CHD3 clones selected contained sequences C-terminal from residue 1551 The shortest clone indicated that the region of interaction C-terminal from amino acid 1839 still contains binding activity [51] Hence there is growing evidence indicating that the C-terminal region of CHD3 plays a crucial physiological role Experimental procedures Yeast two-hybrid assays The two-hybrid system first described by Fields and Song [52] enables the capture of cellular proteins interacting with a specific protein used as a bait We have used the Matchmaker system from Clontech, a version of the system based on the GAL4 transcription factor A hybrid of GAL4 DNA-binding domain and the protein of interest is used as the bait A library of cellular proteins expressed as fusions with the GAL4 transcription activation domain is screened for those that interact with the bait, thereby bridging GAL4 BD and AD and activating transcription of a reporter gene containing a GAL upstream activating element ERM-containing baits were generated by PCR amplification with Pfu polymerase (Stratagene, La Jolla, CA) and inserted between the EcoRI and BamHI sites of the plasmid pGBKT7 (Clontech, Palo Alto, CA) in order to generate in frame fusions with the Gal4BD (amino acids 1–147) The bait used originally to screen the brain cDNA library in ACT2 (Cat #HL4004AH; Clontech) contained the 984 bp 3¢-terminal portion of ERM or C-terminal residues 96–510 [26] Baits containing subfragments of ERM were generated similarly with the following oligonucleotides listed in Table 1: residues 96–510, primers 96FW and 510R where EcoRI and BamHI sites were added to ERM sequences to direct insertion; residues 96–454, primers 96FW and 454R; residues 342–510, 342FW and 510R; residues 342–454, 342FW and 454R; residues 447–510, 447FW and 510R; residues 96–349, 96FW and 349R In C-terminal deletions (Fig 1C) the common sense primer was 96FW In N-terminal deletions the common antisense primer was 349Rb PCR conditions were at 94 °C, 30 cycles with (30 s at 94 °C, 30 s at annealing temperature, 90 s at 72 °C), and 10 at 72 °C Annealing temperature was usually °C below the Tm AH109 competent cells from Clontech were transformed with each bait In the original screening of the library a total of 1.5 · 106 independent transformants were screened 1444 and two independent CHD3 clones were obtained Sequencing revealed that they were identical and contained CHD3 sequences from amino acids 1676–2000 To examine the activity of subfragments from the original bait, AH109 cells were transfected with each bait together with pACT2.CHD3 (amino acids 1676–2000) Analysis of the activity of CHD3 domains Various CHD3 subclones spanning most of the protein sequence were derived by PCR amplification using Pfu (Stratagene) from a set of clones generously provided by F Aubry [29] CHD3 fragment from amino acids 295–1717 was derived from clone 37-1 [29] with primers 37-1S and 371A including the NheI and BstZI sites, respectively (Table 1) and inserted into the corresponding sites of pC1 (Promega, Madison, WI) Primers also included an extra amino acid 5¢-sequence providing and ATG translation start site in the context of a sequence obeying the Kozak consensus CHD3 fragment from amino acids 1005–2000 was derived from clone 37-9 [29] with the primers 37-9S and 37-9A CHD3 fragment from amino acids 1327–2000 was derived from clone 37-8 with the primers 37-8S and 37-9A CHD3 fragment from amino acids 1676–2000 was derived from the clone obtained in our yeast two-hybrid selection with the sense primer 1676S and the reverse primer 37-9A Constructs into pCMV-Tag2 (Stratagene) were generated in order to analyze the CHD3 domains required for interactions with the PS1 promoter The maximum construct with amino acids 1676–2000 was derived by PCR amplification with Pfu polymerase and the primers 1676ST (sense) and 2000AT (antisense) including the EcoRI and SalI sites, respectively, and inserted between the EcoRI and XhoI sites of pCMV-Tag form C A series of N-terminal deletions were derived using sense primers including an EcoRI site: 1741S, 1800S, 1810S, 1818S, 1830S, 1839S, 1851S, 1861S, 1872S, 1877S, 1891S, 1904S, 1914S, 1924S and 1943S The common antisense primer was 2000AX and included an XhoI site C-Terminal deletions were also constructed with the following primers including a SalI site: 1955A, 1902A, 1889A, 1877A, 1870A, 1862A, 1851A, 1843A, 1832A, 1821A, 1810A, 1801A and 1790A The common sense primer was 1676ST and included and EcoRI site The same series of inserts was inserted into the EcoRI and XhoI sites of pACT2 in order to also test the CHD3 domains in yeast two-hybrid binding assays Transfection assays in SH-SY5Y neuroblastoma cells Transfection by calcium phosphate precipitation and glycerol shock has been described previously [16] Cells were seeded at a density of 104Ỉcm)2, day before transfection FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das Regulation of the presenilin gene Table Primers ERM 96FW: 342FW: 349R: 447FW: 454R: 510R: ERM N-terminal deletions 140S: 200S: 304S: 343S: 349Rb: ERM C-terminal deletions 320A: 299A: 279A: 256A: 239A: 219A: 199A: CHD3 subclones 37-1S: 37-1A: 37-9S: 37-9A 37-8S: 1676S: CHD3 inserts in pCMV-Tag2 1676ST: 2000AT: 2000AX: N-terminal deletions 1741S: 1800S: 1810S: 1818S: 1830S: 1839S: 1851S: 1861S: 1872S: 1877S: 1891S: 1904S: 1914S: 1924S: 1943S: C-terminal deletions 1955A: 1902A: 1889A: 1877A: 1870A: 1862A: 1851A: 1843A: 1832A: GATCGAATTCTCCTCTGAGCTGTCGTCTTGTA GATCGAATTCCCTGAGAGACTGGAAGGCAAAG GATCGGATCCACTTTGCCTTCCAGTCTCTCAG GATCGAATTCTTTGTCTGTGACCCAGATGC GATCGGATCCTTAGAGGGCATCTGGGTCACAG GATCGGATCCACTCCGCCACTCAGAAACTTAG GATCGAATTCTCACCCACCCATCAGAATC GATCGAATTCCCCCTGCAGATGCCAAAGATG GATCGAATTCGAAGTGCCTAACTGC GATCGAATTCGAGAGACTGGAAGGCAAAG GATCGGATCCTCATTTGCCTTCCAGTCTCTCAG GATCGGATCCTCAGCTGGAGAAATAAC GATCGGATCCTCAGTAATCCCGAGGCTCCTG GATCGGATCCTCATGGCATGCCCGGGAC GATCGGATCCTCAGGGAGCTGCAGGGAC GATCGGATCCTCAATTATCTCCAGGAAC GATCGGATCCTCACTGAAATCTCTGTTC GATCGGATCCTCACTGATGTGGTGGTC GATCGCTAGCGTGTGATGAAGGCGCTAGGGCTTCTGGGT GATCCGGCCGTCATGTGAAGCCACCAT GATCGCTAGCGTGTGATGAAGGCGGAGGCCTTGAATTCACG GATCCGGCCGATCCAGTCAGTCGTCTATAC GATCGCTAGCGTGTGATGAAGGCGGAGCAACAGCAGGAAGAC GATCGCTAGCGTGTGATGAAGGCGGAAGATGTAAAAGGTG GATCGAATTCTGGAAGATGTAAAAGGTG GATCGTCGACATCCAGTCAGTCGTCTATAC GATCCTCGAGATCCAGTCAGTCGTCTATAC GATCGAATTCACAGAAGACATGA, GATCGAATTCTGGAGCAGGCGCTG GATCGAATTCTGCGGCGGGCGGCCTACTCG, GATCGAATTCTGTCGCAGGAGCCGGCGCAG, GATCGAATTCACGCCCGCTTCGCCGAG, GATCGAATTCTGGCCGAGAGCCACCAGCAC, GATCGAATTCTGGCGGGGAACAAGCCG, GATCGAATTCTGCACAAGGTTCTGAACCA, GATCGAATTCTGAGCGACATGAAGGCGGAC, GATCGAATTCTAGCGGACGTGACCCGCCTG, GATCGAATTCCCATCGCAGCCCGCCTTCAGATG, GATCGAATTCTCAGCCGGCTGGCCAGCA, GATCGAATTCCTCACCCCACACCGGCCTAC, GATCGAATTCCCTACGCTACACCTCCG, GATCGAATTCTGGCCGCCGCAGGC, GATCGTCGACTCATGCAGGCATCTGGCTGTAATTG GATCGTCGACTCAGCTGCGCTCGGACATCTGAAGGC GATCGTCGACTCATATTCGGGACAGCGTGGCTG GATCGTCGACTCACGCCTTCATGTCGCTCAGCAAC GATCGTCGACTCA CTC CTC CAG CTG GTT CAG AAC CTT G GATCGTCGACTCA GTG CAG GAC GGC GTT GGC GATCGTCGACTCA CAG CGA CTC CTT GGA GAG G GATCGTCGACTCA GTG GCT CTC GGC CAG GCA C GATCGTCGACTCA GCG GGC GTG GAG GGC CAT GG FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1445 Regulation of the presenilin gene M Pastorcic and H.K Das Table Continued 1821A: 1810A: 1801A: 1790A: ChiP PS1()25 to +66): PS1(+ 45 to +100): IRL: GATCGTCGACTCA GATCGTCGACTCA GATCGTCGACTCA GATCGTCGACTCA CGACGCCAGAGCCGGAAATGAC (sense), TTCCGATGTGAAACCGCGGACC (antisense) GGTCCGCGGTTTCACATCG (sense), GCTCAGGTTCCTTCCAGAC (antisense) TTTGCTGTCTCAGGCCCTTTATA (sense), ATGAATGGAGAGGATCTGCTACG (antisense) Promoter activity was determined by chloramphenicol acetyl transferase (CAT) assay in different samples and was standardized using the amount of protein present in the cellular extracts as an internal control as described previously [16] Each experiment was repeated three times, with at least triplicate tests of each construct and treatment The ERM expression construct pC1.ERM used in Fig has been described previously [15] and included the entire cDNA (full-length ERM protein) Sequences from position 132–2066 according to gi: 33873571 were inserted between the MluI and SalI of pC1 Lipofectamine 2000 transfections (Invitrogen, Carlsbad, CA) were according to the manufacturer’s instructions with the following modifications On transfection day, medium in cm plates was replaced by 2.5 mL serum-free modified Eagle’s medium For each plate: 0.25 mL of serum free medium containing 10 lL of lipofectamine were combined with 0.25 mL medium containing lg DNA, after 20 the 0.5 mL mixture was added to the plates and cells were returned to the incubator for h The lipofectamine solution was then removed and replaced by culture medium including 10% fetal bovine serum (HyClone, Logan, UT) Cells were refed after 24 h and harvested at 40 h after transfection Chromatin immunoprecipitation SH-SY5Y cells were transiently transfected with lg of pCMV-Tag2–CHD3 expressing the Flag tag–CHD3 fusion protein (amino acids 1676–1877 or 1676–2000) or the empty control pCMV-Tag2 vector by lipofectamine Forty hours after transfection cells were cross-linked with 1% formaldehyde in serum-free modified Eagle’s medium for 10 at room temperature Cells were then washed with NaCl ⁄ Pi and treated with 0.125 m glycine for to stop the reaction Cells were washed again and harvested in NaCl ⁄ Pi containing protease inhibitors at °C Cells were lyzed and enzymatic chromatin shearing was performed as directed by the kit from Active Motif (Carlsbad CA) The nuclear protein–DNA complexes were immunoprecipitated by incubation with anti-Flag M2 agarose beads from Sigma (St Louis, MO) overnight at °C with rotation in IP buffer (20 mm Tris pH 8.0, 150 mm NaCl, mm EDTA, 1% Triton X-100, 10% glycerol, and protease inhibitors) The resin was collected and washed successively with IP buffer, high salt buffer (20 mm Tris pH 8.0, 1% Triton X-100, 1446 CTC CTG CGA CAG GTT CAG GTA G CAGCTGCTCCTCAAT C CTCCAGGAGCTTGAACCTCCG ATTTTTCATCTCCAGAAAGTTC mm EDTA, 500 mm NaCl) and LiCl buffer (20 mm Tris pH 8.0, 0.1% NP40, mm EDTA, and 250 mm LiCl), TE buffer (10 mm Tris pH 8.0 and mm EDTA) and eluted with 1% SDS, 0.1 m NaHCO3 Cross-links were reversed by incubation overnight at 65 °C in the presence of 200 mm NaCl Samples were treated with RNase and DNA was purified with minielute spin columns (Qiagen, Valencia, CA) Samples were analyzed by PCR with the primers PS1()25 to +66) and PS1()45 to +100) as well as IRL (the amplified fragment corresponds to position 35 821–35 980 of the sequence gi:2440066 for the monoamine oxydase B gene) primers as a control (Table 1) DNA was fractionated by electrophoresis on 12% polyacrylamide gels For ChIP assay of the endogenous CHD3 expressed in SH-SY5Y cells, complexes were precipitated with antibodies to CHD3 (sc-11378X, Santa Cruz Biotechnology, Santa Cruz, CA) and ERM (aERM1: sc-1955X or aERM2: sc22807X) Antibody complexes were captured with protein A ⁄ G (Santa Cruz Biotechnology) Western blot analysis SH-SY5Y cells were transiently transfected with lg of pCMV-Tag2 or pCMV-Tag2ỈCHD3 using lipofectamine Total cellular proteins (50 lg) were fractionated by electrophoresis on denaturing 12% polyacrylamide gels and analyzed by western blotting using successively anti-PS1 (MAB5232; Chemicon, Temecula, CA), anti-Flag (F1804; Sigma), and anti-GAPDH (MAB374; Chemicon) as described previously [16] Acknowledgements This research was supported by a grant from the National Institutes of Health (AG 18452) We wish to thank Dr Florence Aubry (CNRS, France) for CHD3 ⁄ ZFH clones References Dewji NN, Valdez D & Singer SJ (2004) The presenilins turned inside out: implications for their structures and functions Proc Natl Acad Sci USA 101, 1057– 1062 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS M Pastorcic and H.K Das Li X & Greenwald I (1998) Additional evidence for an eight-transmembrane-domain topology for Caenorhabditis elegans and human presenilins Proc Natl Acad Sci USA 95, 7109–7114 Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K et al (1995) Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease Nature 375, 754–760 Tanzi RE, Kowacs DM, Kim TW, Moir RD, Guenette SY & Wasco W (1996) The gene defects responsible for familial Alzheimer’s disease Neurobiol Dis 3, 159–168 Chyung JH, Raper DM & Selkoe DJ (2005) Gammasecretase exists on the plasma membrane as an intact complex that accepts substrates and effects intramembrane cleavage J Biol Chem 280, 4383–4392 De Strooper B (2003) Aph-1, Pen-2, and nicastrin with presenilin generate an active-secretase complex Neuron 38, 9–12 Kimberly WT, LaVoie MJ, Ostaszewski BL, YeW, Wolfe MS & Selkoe DJ (2003) Gamma-secretase is a membrane protein complex comprised of presenilin, nicastrin, Aph-1, and Pen-2 Proc Natl Acad Sci USA 100, 6382–6387 Takasugi N, Tomita T, Hayashi I, Tsuruoka M, Niimura M, Takahashi Y, Thinakaran G & Iwatsubo T (2003) The role of presenilin cofactors in the c-secretase complex Nature 422, 438–441 De Strooper B, Saftig P, Craessaerts K, Vanderstichele H, Guhde G, Annaert W, Von Figura K & Van Leuven F (1998) Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein Nature 391, 387390 10 Kopan R & Goate A (2000) A common enzyme connects Notch signaling and Alzheimer’s disease Genes Dev 14, 2799–2806 11 Koo EH & Kopan R (2004) Potential role of presenilinregulated signaling pathways in sporadic neurodegeneration Nat Med 10, S26–S33 12 Thinakaran G & Parent AT (2004) Identification of the role of presenilins beyond Alzheimer’s disease Pharmacol Res 50, 411–418 13 Okamoto I, Kawano Y, Murakami D, Sasayama T, Araki N, Miki T, Wong AJ & Saya H (2001) Proteolytic release of CD44 intracellular domain and its role in the CD44 signaling pathway J Cell Biol 155, 755– 761 14 Marambaud P, Wen PH, Dutt A, Shioi J, Takashima A, Siman A & Robakis NK (2003) A CBP binding transcriptional repressor produced by the PS1 ⁄ -cleavage of N-cadherin is inhibited by PS1 FAD mutations Cell 114, 635–645 15 Pastorcic M & Das HK (2004) Alternative initiation of transcription of the human presenilin gene in SHSY5Y and SK-N-SH cells The role of Ets factors in the Regulation of the presenilin gene 16 17 18 19 20 21 22 23 24 25 26 27 28 regulation of presenilin Eur J Biochem 271, 4485– 4494 Pastorcic M & Das HK (1999) An upstream element containing an ETS binding site is crucial for transcription of the human presenilin-1 gene J Biol Chem 274, 24297–24307 Pastorcic M & Das HK (2003) Ets transcription factors ER81 and Elk1 regulate the transcription of the human presenilin gene promoter Brain Res Mol Brain Res 113, 57–66 Sharrocks AD (2001) The ETS-domain transcription factor family Nat Rev, Mol Cell Biol 2, 827–837 Oikawa T & Yamada T (2003) Molecular biology of the Ets family of transcription factors Gene (Amst) 303, 11–34 Laudet V, Hanni C, Stehelin D & Duterque-Coquillaud M (1999) Molecular phylogeny of the ETS gene family Oncogene 118, 1351–1359 Monte D, Baert JL, Defossez PA, de Launoit Y & Stehelin D (1994) Molecular cloning and characterization of human ERM, a new member of the Ets family closely related to mouse PEA3 and ER81 transcription factors Oncogene 9, 1397–1406 de Launoit Y, Chotteau-Lelievre A, Beaudoin C, Coutte L, Netzer S, Brenner C, Huvent L & Baert JL (2000) The PEA3 group of ETS-related transcription factors Role in breast cancer metastasis Adv Exp Med Biol 480, 107–116 de Launoit Y, Baert JL, Chotteau-Lelievre A, Monte D, Coutte L, Mauen S, Firlej V, Degerny C & Verreman K (2006) The Ets transcription factors of the PEA3 group: transcriptional regulators in metastasis Biochim Biophys Acta 1766(1), 79–87 Werner MH, Clore M, Fisher CL, Fisher RJ, Trinh L, Shiloach J & Gronenborn AM (1995) The solution structure of the human ETS1–DNA complex reveals a novel mode of binding and true side chain intercalation Cell 83, 761–771 Donaldson LW, Petersen JM, Graves BJ & McIntosh LP (1996) Solution structure of the ETS domain from murine Ets-1: a winged helix–turn–helix DNA binding motif EMBO J 15, 125–134 de Launoit Y, Baert JL, Chotteau A, Monte D, Defossez PA, Coutte L, Pelczar H & Leenders F (1997) Structure–function relationships of the PEA3 group of Ets-related transcription factors Biochem Mol Med 61, 127–135 Defossez PA, Baert JL, Monnot M & de Launoit Y (1997) The ETS family member ERM contains an alpha-helical acidic activation domain that contacts TAFII60 Nucleic Acids Res 25, 4455–4463 Laget MP, Defossez PA, Albagli O, Baert JL, Dewitte F, Stehelin D & de Launoit Y (1996) Two functionally distinct domains responsible for transactivation by the Ets family member ERM Oncogene 12, 1325–1336 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS 1447 Regulation of the presenilin gene M Pastorcic and H.K Das 29 Aubry F, Mattei MG & Galibert F (1998) Identification of a human 17p-located cDNA encoding a protein of the Snf2-like helicase family Eur J Biochem 254, 558– 564 30 Woodage T, Basrai MA, Baxevanis AD, Hieter P & Collins FS (1997) Characterization of the CHD family of proteins Proc Natl Acad Sci USA 94, 11472–11477 31 Ge Q, Nilasena DS, O’Brien CA, Frank MB & Targoff IN (1995) Molecular analysis of a major antigenic region of the 240 kD protein of Mi-2 autoantigen J Clin Invest 96, 1730–1737 32 Mauen S, Huvent I, Raussens V, Demonte D, Baert JL, Tricot C, Ruysschaert JM, Van Lint C, Moguilevsky N & de Launoit Y (2006) Expression, purification, and structural prediction of the Ets transcription factor ERM Biochim Biophys Acta 1760, 1192–1201 33 Greenall A, Willingham N, Cheung E, Boam DS & Sharrocks AD (2001) DNA binding by the ETS-domain transcription factor PEA3 is regulated by intramolecular and intermolecular protein–protein interactions J Biol Chem 276, 16207–16215 34 Bojovic BB & Hassell JA (2001) The PEA3 Ets transcription factor comprises multiple domains that regulate transactivation and DNA binding J Biol Chem 276, 4509–45021 35 Janknecht R (2001) Cell type-specific inhibition of the ETS transcription factor ER81 by mitogen-activated protein kinase-activated protein kinase J Biol Chem 276, 41856–41861 36 Wu J & Janknecht R (2002) Regulation of the ETS transcription factor ER81 by the 90-kDa ribosomal S6 kinase and protein kinase A J Biol Chem 277, 42669– 42679 ´ 37 Degerny C, Monte D, Beaudoin C, Jaffray E, Portois L, Hay RT, de Launoit Y & Baert JL (2005) SUMO modification of the Ets-related transcription factor ERM inhibits its transcriptional activity J Biol Chem 280, 24330–24338 38 Baert JL, Beaudoin C, Coutte L & de Launoit Y (2002) ERM transactivation is up-regulated by the repression of DNA binding after the PKA phosphorylation of a consensus site at the edge of the ETS domain J Biol Chem 277, 1002–1012 39 Minty A, Dumont X, Kaghad M & Caput D (2000) Covalent modification of p73alpha by SUMO-1 Twohybrid screening with p73 identifies novel SUMO-1interacting proteins and a SUMO-1 interaction motif J Biol Chem 275, 36316–36323 40 Romani M, Tonini GP, Banelli B, Allemanni G, Mazzocco K, Scaruffi P, Boni L, Ponzoni M, Pagnan G, 1448 41 42 43 44 45 46 47 48 49 50 51 52 Raffaghello L et al (2003) Biological and clinical role of p73 in neuroblastoma Cancer Lett 197, 111–117 Tong JK, Hassig CA, Schnitzler GR, Kingston RE & Schreiber SL (1998) Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex Nature 395, 917–921 Koipally J, Renold A, Kim J & Georgopoulos K (1999) Repression by Ikaros and Aiolos is mediated through histone deacetylase complexes EMBO J 18, 3090–3100 Kim J, Sif S, Jones B, Jackson A, Koipally J, Heller E, Winandy S, Viel A, Sawyer A, Ikeda T et al (1999) Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes Immunity 10, 345–355 Gill G (2005) Something about SUMO inhibits transcription Curr Opin Genet Dev 15, 536–541 Pastorcic M & Das HK (2000) Regulation of transcription of the human presenilin-1 gene by ets transcription factors and the p53 protooncogene J Biol Chem 275, 34938–34945 Schultz DC, Friedman JR & Rauscher FJ III (2001) Targeting histone deacetylase complexes via KRAB-zinc finger proteins: the PHD and bromodomains of KAP-1 form a cooperative unit that recruits a novel isoform of the Mi-2alpha subunit of NuRD Genes Dev 15, 428– 443 Hong W, Nakazawa M, Chen YY, Kori R, Vakoc CR, Rakowski C & Blobel GA (2005) FOG-1 recruits the NuRD repressor complex to mediate transcriptional repression by GATA-1 EMBO J 24, 2367–2378 Kehle J, Beuchle D, Treuheit S, Christen B, Kennison JA, Bienz M & Muller J (1998) dMi-2, a Hunchbackinteracting protein that functions in polycomb repression Science 282, 1897–1900 Murawsky CM, Brehm A, Badenhorst P, Lowe N, Becker PB & Travers AA (2001) Tramtrack69 interacts with the dMi-2 subunit of the Drosophila NuRD chromatin remodelling complex EMBO Rep 2, 1089–1094 Srinivasan R, Mager GM, Ward RM, Mayer J & Svaren J (2006) NAB2 represses transcription by interacting with the CHD4 subunit of the nucleosome remodeling and deacetylase (NuRD) complex J Biol Chem 281, 15129–15137 Lemos TA, Passos DO, Nery FC & Kobarg J (2003) Characterization of a new family of proteins that interact with the C-terminal region of the chromatin-remodeling factor CHD-3 FEBS Lett 533, 14–20 Fields S & Song O (1989) A novel genetic system to detect protein–protein interactions Nature 340, 245– 246 FEBS Journal 274 (2007) 1434–1448 ª 2007 The Authors Journal compilation ª 2007 FEBS ... SalI site: 19 55A, 19 02A, 18 89A, 18 77A, 18 70A, 18 62A, 18 51A, 18 43A, 18 32A, 18 21A, 18 10A, 18 01A and 17 90A The common sense primer was 16 76ST and included and EcoRI site The same series of inserts... (end points at 18 01 and 18 10 not shown) 14 38 Unlike the effects on PS1 transcription (Fig 6A), further deletions with end points at amino acids 18 10, 18 18, 18 30, 839, 18 51 and 18 61 did not affect... 18 18S: 18 30S: 18 39S: 18 51S: 18 61S: 18 72S: 18 77S: 18 91S: 19 04S: 19 14S: 19 24S: 19 43S: C-terminal deletions 19 55A: 19 02A: 18 89A: 18 77A: 18 70A: 18 62A: 18 51A: 18 43A: 18 32A: GATCGAATTCTCCTCTGAGCTGTCGTCTTGTA