Báo cáo Y học: Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein doc

... Cloning and characterization of the mammalian-speciﬁc nicolin 1 gene (NICN1) encoding a nuclear 24 kDa protein Bianca Backofen 1, *, Ralf Jacob2,*, Katrin Serth3, Achim Gossler3, Hassan ... acids and has a calculated molecular weight of 24 kDa (Fig. 1) . The aminoacid sequences of the NICN1 proteins are 94% identicalbetween human and dog, and 89% identical betweenhuman and mouse. The ... databases. The novel gene was termed nicolin 1 (NICN1). A BLAST search against the EST-database with the NICN1 cDNA resulted in 85 exclusivelymammalian hits with E-values < 10 )10 . The databasesearches...

Báo cáo Y học: Cloning and characterization of novel snake venom proteins that block smooth muscle contraction pptx

... Cloning and characterization of novel snake venom proteinsthat block smooth muscle contractionYasuo Yamazaki 1 , Hisashi Koike 1 , Yusuke Sugiyama 1 , Kazuko Motoyoshi 1 , Taeko Wada 1 ,Shigeru ... Hishinuma2, Mitsuo Mita2 and Takashi Morita 1 Departments of 1 Biochemistry; and 2Pharmacodynamics, Meiji Pharmaceutical University, Tokyo, JapanIn this study, we isolated a 25 -kDa novel snake ... doi :10 .10 46/j .14 32 -10 33.2002.02940.xpurchased from Seikagaku Corporation (Tokyo, Japan).Other chemicals were of analytical grade (Sigma–Aldrich,Amersham–Pharmacia Biotech., Wako Pure Chemical Ind. and Kanto Chemical Co.).Puriﬁcation...

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

... and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI and XhoIML3p A- chain5¢-GATATACATATGTACCGTCGTATTAGCCTTCGTGTCACGGAT-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI and EcoRIML3.1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACGAATTCTTATTAAGAAGAAGAAGAACGGTCCCTGCATAC-3¢NdeI ... cloning ML1p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGCTCACCGCA-3¢NdeI and XhoIML2p A- chain5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢NdeI ... round of PCR wascloned and the 10 66 bp sequence encoding 12 5 amino acids of the A- chain, the 19 amino acids linker, and 216 aminoacidsoftheB-chainoftheml gene was obtained. The sequence was different...

Báo cáo khoa học: Cloning and expression of the ﬁrst nonmammalian interleukin-11 gene in rainbow trout Oncorhynchus mykiss pdf

... (28) 13 .5 (24) 23.0 ( 41) 23.6 (42) 21. 9 (39) 21. 3 (38)Positive charged a (%) 9.9 (18 ) 12 .4 (22) 11 .8 ( 21) 11 .8 ( 21) 11 .8 ( 21) 11 .8 ( 21) Isoelectric point 7. 91 9.83 11 .16 10 . 71 11. 16 11 .16 a Percentage ... underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG ( 31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlightingin bold and italics. The ... 3¢-UTR. The major differ-ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG( 31 bp) in the 3¢-UTR of the cDNA...

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... forward)45¢-GTATCAGCTTC(C ⁄ T)TCAAATGTC-3¢ PsCBL (degenerate reverse)55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward)65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse)75¢-CGAGCTCACTGCCTCTCAAC-3¢ ... component of the nucleolus and sti-mulated by phosphorylation with CK2 and cdc2 protein kinases. Plant J 25, 9 17 .32 Yadav N, Chandok MR, Prasad J, Bhattacharya S,Sopory SK & Bhattacharya A (19 97) ... showsvariation from the canonical EF hand. The amino acidD at position 1, of EF1 is replaced by amino acid A (Fig. 1B). The EF1 and EF2 are 22 amino acids apart,whereas EF2 and EF3, and EF3 and...

Tài liệu Báo cáo khóa học: Cloning and characterization of two distinct isoforms of rainbow trout heat shock factor 1 ppt

... 5¢-TTCCAAGAGCTGAACAAACCATTG-3¢;HSF1b forward, 5¢-GAAGCAGCTGGTCCAGTACACCTC-3¢; HSF1b reverse, 5¢-GGCTGAATAAACCATGCCAGTAGC-3¢; HSC70 forward, 5¢-ACATCAGCGACAACAAGAGG-3¢; HSC70 reverse, 5¢-AGCAGGTCCTGGACATTCTC-3¢. ... PCR was performed with the M13forward primer (5¢-CCCAGTCACGACGTTGTAAAACG-3¢)asasenseprimerandHSF1-speciﬁc primers (forHSF 1a, 5¢-GAAGCAGCTTGTCCAGTACACTAA-3¢;forHSF1b,5¢-GAAGCAGCTGGTCCAGTACACCTC-3¢)asantisense ... beendescribed by several authors [19 , 21, 22], namely, the regula-tory domain and the transactivation domain, respectively.Green et al. [ 21] have shown that the central regulatorydomain of human HSF1 regulates...

Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx

... 5¢-GATGGTATTGATTTTGCCATAGAGCATGGTTCA-3¢Anti-sense strand 5¢-TGAACCATGCTCTATGGCAAAATCAATACCATC-3¢Asp125Asn Sense strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala ... 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢Anti-sense strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢Anti-sense ... the Asp125Ala/Glu127Ala and Asp125Ala/Tyr183Phe doublemutants, and the Asp125Ala/Glu127Ala/Tyr183Phe triplemutant. The single Asp125Ala and Glu127Ala mutants hadapproximately 2% of the wild-type...

Báo cáo Y học: Cloning and expression of sterol D14-reductase from bovine liver potx

... and fungi [10 ]. Gene c loning of D14-SR from Ara bidopsis thaliana and analysis o f m utants has h ighlighted the role of the protein in cell growth and embryonic development of the plant [11 ,12 ].Inherited ... two parts ( Fig. 1) ,which accounted for the calculated molecular mass of  46.7 kDa. Therefore, the discrepancy between the appar-ent molecular mass of 38 kDa estimated by SDS/PAGE and the calculated ... an ORF of 12 57 bp, encoding a protein of 418 amino a cids with a calculated molecular mass of 46 7 51 Da. The N-terminal amino-acid sequence of the protein puri®ed from liver and the amino-acid...

Báo cáo Y học: Isolation and characterization of a thioredoxin-dependent peroxidase from Chlamydomonas reinhardtii doc

... l1 918 5; barley: BAS1, Z34 917 , PER1, X965 51; Arabidopsis: BAS1, X97 910 , TPx2, AF1 213 56,MHF15 .19 , AF3268 71, Per1, O04005; Chlamydomonas Ch-Prx1, AJ304857; spinach B AS1, ´ 94 219 ; mouse TPx, u20 611 ; ... using an intensifying s creen, at )80 °C.RNA for Northern analyses was isolated as describedabove and separated in a 1. 3% agarose/formaldehyde gel. The RNA was b lotted to a nylon membrane (ZetaProbe,Bio-Rad) ... Afterwashing [17 ], the membrane was exposed t o X-ray ®lm withan intensifying screen at )80 °Cfor 2days.Antioxidant activity of the Ch-Prx1 protein The antioxidant activity of the Ch-Prx1 protein...

Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc

... K-dependent carboxylase: effect of ammonium sulfate onsubstrate carboxylation and on inhibition by stereospific substrateanalogs. Biochim. Biophys. Acta 10 34, 11 16 . 51. Bandyopadhyay, P.K., Garrett, ... C-terminalextension relative to the mammalian carboxylases. The Conus carboxylase has 811 amino acids compared with758 amino acids for most of the mammalian carboxylas-es. The large central portion ... K-dependent carboxylases revealed marked (> 90%) amino-acid sequence conservation, and the toadfish carboxylaseshowed 70% amino-acid sequence similarity to the mam-malian carboxylases [8 11 ]. The...

Xem thêm

Từ khóa: báo cáo y học báo cáo y học cổ truyền mẫu báo cáo y học cổ truyền bao cao y hoc colchicin phan ban luan trong bao cao y hoc co truyen cloning and characterization of dao gene and promoter isolation and characterization of the cryptophycins detection and characterization of the t cell receptor repertoire isolation and characterization of the microprocessor complex experimental procedures for the purification and characterization of the arabinanases and galactanases amplification cloning and sequencing of the srv 2 env genes 03 design modeling microfabrication and characterization of the micro gas chromatography columns substituted phenol derivatives on pt electrode from aqueous acidic solution kinetics mechanism electrochemical studies and characterization of the polymer obtained expression identification of il 18 producing cells and characterization of the periductal mononuclear cell infiltrates in salivary glands of patients with ss and controls bài báo báo cáo khoa học 3 bài đăng trên tạp chí chuyên ngành 1 bài đăng trên tuyển tập hội nghị khoa học quốc tế Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tin Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP