detection and characterization of the t cell receptor repertoire

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Ngày tải lên : 16/02/2014, 09:20
... AGTGAGATGGATACAGGTGCTAAAC TCTGGACCTCAGACATGAACTTACT TGTCAGTCCTCTTTAATGCT AATGGTATCCTGTTTGGCTCAG GGTTGTAATTGTACACGGTAGTC CGGTAGTCAGGAAATCAATGCC CCATGTCTGCAGATGGTCGAGG GGACTGACATTGCTCCAGAGC GCTTCAGTGACTCAGAAATTGG ... TGAGTTACACGTTCAGTCAGCAATATG Real-time TCTTGGTCTTTAGTTCTTATCATCTTGAGC Real-time AAGATTCTCAGCTACATAATGCACACC Real-time ATGCTCATCAGTAGATTCTGCTCAC Real-time ACGCTTCTTCTTTGCGACTG Real-time CACCATATCCCGCTTGAGTT Real-time ... GCTTCAGTGACTCAGAAATTGG GTCCAGAATATTCAGCCTTTCACC CTCCCTCAAACAAACCAGAGTC CACTGGATGAGACAGGAAGTT CTTCTCCAGGACAGTCCAAAGAGTC CTGGATTGAAGCGCCCTCGGTTAATC GCTGCCTTTGTTATTTGTAAGCTTCAG GGAAACTTCCTGTCTCATCCAGTG...
  • 20
  • 689
  • 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Ngày tải lên : 08/03/2014, 02:20
... averaged, and the negative control subtracted The short half-life of 32P necessitated determination of the specific radioactivity of the phosphate at the time of the assay from the Ôtotal radioactivityÕ ... Consequently, tyrosines located on the peptides may be expected to exhibit the same kinetics as those located on the intact protein Therefore, determination of the kinetics of phosphorylation of these ... concentrations of peptide or ATP, the latter giving rise to near saturation (95%) of the enzyme [19] It was therefore assumed that the extent of phosphorylation at 30 is directly proportional to the phosphorylation...
  • 8
  • 570
  • 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt

Ngày tải lên : 07/03/2014, 16:20
... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...
  • 9
  • 485
  • 0
Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Báo cáo khoa học: Detection and characterization of a novel extracellular fungal enzyme that catalyzes the specific and hydrolytic cleavage of lignin guaiacylglycerol b-aryl ether linkages pdf

Ngày tải lên : 17/03/2014, 03:20
... dehydration generates the quinonemethide from GOG (structure II) The reaction mixture turned yellow as a result of formation of the quinonemethide The scheme is consistent with the fact that the ... Analysis of the products of the reaction revealed the presence of guaiacylglycerol (GG) and 4MU (data not shown) Localization of enzymatic activity To confirm the localization of the b-aryl ether ... specificity of the Ca structure and p-hydroxyl group, the b-aryl ether cleavage enzyme could react with DHP-GOU This result indicates reactivity for the structure that retained the Ca alcohol and...
  • 10
  • 670
  • 0
Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Báo cáo Y học: Puri®cation and characterization of the human adenosine A2a receptor functionally expressed in Escherichia coli doc

Ngày tải lên : 24/03/2014, 00:21
... analysis and Amido black assays indicated that the latter underestimated the amount of puri®ed receptor fusion protein by 12% Protein concentrations of ®nal puri®ed receptor given in the text and tables ... properties of the canine adenosine A2a receptor [27] This indicates that the truncated receptor puri®ed by us is suf®cient to ful®l the main receptor functions and is appropriate for structural and ... cDNA The codon for the last used amino acid of the receptor (Ser412 in case of the full-length receptor and Ala316 for the truncated receptor) was followed by the nucleotide sequence GCGGCCGCA that...
  • 11
  • 582
  • 0
Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx

Báo cáo hóa học: " Comparison of T-cell receptor repertoire restriction in blood and tumor tissue of colorectal cancer patients" docx

Ngày tải lên : 18/06/2014, 16:20
... study was the application of mathematical markers to describe the global restriction of the αβ TCR repertoire in the different compartments rather than the detection of single expanded T- cell clones ... measurements and analyses NCN collected samples and participated in the conduct of the study ET participated in design and conduct of the study UK participated in design and conduct of the study DN ... degradation were excluded from further analysis The aim of our study was the detection of TCR repertoire restriction due to T- cell expansions associated with significant TCR expression of the expanded...
  • 9
  • 416
  • 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Ngày tải lên : 18/06/2014, 16:20
... upon boosting Please note the inverse relationship between functional avidity and the amount of antigen The table (bottom) depicts the major, synergistic features of priming and boosting vectors/regimens, ... strategy could then be matched with heterologous vectors that expand and/ or differentiate the primed cells to therapeutically useful effector T cells or, alternatively, with homologous boosting ... further testing in other heterologous prime-boost vaccine protocols This asymmetry between priming and boosting vectors could very well be at the heart of both the mechanism and advantage of heterologous...
  • 11
  • 505
  • 0
Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx

Báo cáo y học: " The establishment and characterization of the first canine hepatocellular carcinoma cell line, which resembles human oncogenic expression patterns" ppsx

Ngày tải lên : 13/08/2014, 13:20
... c-MET.seq c-MET human.seq TATTCTCTTCTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TATTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCCACTTATGTGAATGTC TCTTCTCTACTTTCATTGGGGAGCACTATGTCCATGTGAACGCTACTTATGTGAACGTA ... GAA GTT TCC CAG TTT CTG AGC AAG GGT ATG GAG CAA CAC AT GTT CCT GGG CAC GTT TTT GTA TGA CTT GGG GTG CTT TCT TGG TGT AAC GGA ATA TGA GGG GGC CAT CTA TC GCA CGT CCA CTT CAT TAC CCA TGC C GGC TGC TCC ... CCAAGAGTGAGAGTACGTTTGGATGAC AGATGTTAGTGACAATGAACCT GTGATTTGTGTGTGCTGATC CGGAGGGACGCCAAACAGG GTCCCGGGTCAACTCTTCGTG TGGAGAGCGTCAACCGGGAGATGT AGGTGTGCAGATGCCGGTTCAGGT ATGGGTAGGGCAAATCAGTAAGAGGT AAGCATCGTATCACAGCAGGTTAC...
  • 10
  • 336
  • 0
The characterization of soluble t cell receptors specific for the parasite toxoplasma gondii

The characterization of soluble t cell receptors specific for the parasite toxoplasma gondii

Ngày tải lên : 09/09/2015, 11:31
... collaborator’s data, I was also able to compare the binding affinities of the three TCR clones with the effector function of the T cells expressing them I observed that the binding affinities of the TCR ... leading to death of the patients receiving the T cells transfusion 74 Thus, care has to be taken to ensure that the engineered TCRs not cross-react strongly with other self-peptides Another limitation ... specific T cells in adoptive T cell transfer whilst the other would be utilizing soluble T cell receptors as therapeutic tools Adoptive T cell transfer has seen much success in the treatment of cancer...
  • 164
  • 367
  • 0
Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Preparation and characterization of the PVDF-based composite membrane for direct methanol fuel cells

Ngày tải lên : 05/09/2013, 16:11
... degradation of the cross-linking structure of the membrane in the H2O2 solution [33] The decomposition rate is larger than the swelling effect after 60 h The result indicates that the stability of PVDF-SPS ... In order to compare the comprehensive character of the membranes, the ratio of proton conductivity and methanol permeability, defined as the selectivity, was calculated The selectivity of PVDF-SPS ... (PVDF)/sulfonated polystyrene (SPS) was adopted to prepare the PVDF composite membrane The structure and the morphology of the PVDF-SPS composite membrane were characterized The proton conductivity and the...
  • 14
  • 596
  • 1
Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Tài liệu Báo cáo khóa học: Non-specific depolymerization of chitosan by pronase and characterization of the resultant products pptx

Ngày tải lên : 19/02/2014, 12:20
... during the chitinolytic activity of chitinase A1 from Bacillus circulans W-12 Replacement of SerfiAla decreased the catalytic activity without affecting the Km, and the mutant retained only 10% of the ... water, thus, supporting the formation of sodiated LMWC when alkali was added The drawbacks of using acetonitrile were, its high cost and flash treatment of the supernatant at elevated temperature, ... wild-type activity It was concluded that Ser might have an important role in maintaining the structural features of the catalytic site On similar lines, it may be tempting to speculate that Asp/...
  • 11
  • 673
  • 0
Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Tài liệu Báo cáo khoa học: Phenol hydroxylase from Acinetobacter radioresistens S13 Isolation and characterization of the regulatory component docx

Ngày tải lên : 21/02/2014, 00:20
... to interact with the reductase moiety This PHI–PHR interaction promotes the PHR conformational changes that are necessary to optimize the mutual orientation of PHR and PHO and thus electron transfer ... ellipticity at k ¼ 200 nm (the absorption region of the peptide bond) reflects the occurrence of a transition between 35° and 55 °C PHI does not interact with phenol The emission spectrum of the ... Triangles and continuous line: data and fitting with PHI/PHO ratio of Asterisks and broken line: data and fitting with PHI/PHO ratio of hypothesis and therefore a direct involvement of PHI in electron transfer...
  • 7
  • 514
  • 0
Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Tài liệu Báo cáo Y học: Identification and characterization of the Escherichia coli stress protein UP12, a putative in vivo substrate of GroEL pptx

Ngày tải lên : 22/02/2014, 07:20
... in the separating and stacking gels, respectively In order to estimate the ratio between the amounts of UP12 and the total amount of protein in the extracts, a series of samples containing determined ... shown that at the beginning of the stationary phase the rate of synthesis of heat-shock proteins increases considerably, but only transiently [2,18] Similarly, we observed that the steady-state ... at the early stationary phase, and its Ó FEBS 2002 steady-state level increases further during the late stationary phase As a result of this accumulation, the relative amount of UP12 in stationary...
  • 9
  • 548
  • 0
Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

Báo cáo khoa học: Purification and characterization of the cysteine proteinases in the latex of Vasconcellea spp. ppt

Ngày tải lên : 07/03/2014, 11:20
... content in their latex; and (2) the presence of other cysteine proteinases or isoforms in the latex To investigate these two hypotheses, the protein concentration per milligram of dried latex, ... Vasconcellea spp Even though the different studies are not consistent about the level of proteolytic activity, probably due to varying experimental conditions, they confirm the potential of Vasconcellea ... for the higher proteolytic activity The amount of latex that can be collected from the (generally smaller) fruits of the wild Vasconcellea plants is definitely lower than the latex yield of papaya...
  • 12
  • 525
  • 0
Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Báo cáo khoa học: Cloning and characterization of the genes encoding toxic lectins in mistletoe (Viscum album L) pot

Ngày tải lên : 07/03/2014, 15:20
... 5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢ 5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGCTCACCGCA-3¢ NdeI and XhoI ML2p A-chain 5¢-GATATACATATGTACGAGCGTCTTCGTCTTCGTGTTACGCATC-3¢ 5¢-CACACCTCGAGTTATTAAGAAGAAGACGGACGGTCCCGGCATAC-3¢ ... intensive than the others Thus, the different intensity of the bands may be the result of a different copy number of the genes in the hybridizing fragments If so, the number of the bands not ... efficiently than the other two genes, and that this is probably the reason for the quantitative prevalence of MLI in extract of mistletoe leaves [18] The A-chains encoded by the three variants of the...
  • 11
  • 610
  • 0
Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

Ngày tải lên : 07/03/2014, 16:20
... nucleophilic attack of the substrate ester bond by the serine alcoholate The shape of the titration curve of the catalytic histidine shows an apparent pKa value of the essential histidine estimated to 4.1 ... the modification of the catalytic properties of the catalytic histidine The strength of the His290-Asp260 hydrogen bond could be reduced due to the proximity of the Arg213 guanidinium moiety that ... (or glutamic) acid To further investigate the biochemical characterization of the enzyme, we have titrated these key residues that form the catalytic triad of Rv1399c Catalytic serine Diethyl paranitrophenyl...
  • 9
  • 584
  • 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf

Ngày tải lên : 08/03/2014, 23:20
... ttgcctgcagTGGAG TCTAGgtaggatggg ATTAGgtaaaagtgc tttcctgcagTGGAG tgttcctcagGCATC CTCAGgtaaaagtgc CCCAGgtgatacctc ccgacctcagGCCTC ctctttgcagGTTGG CATAGgtgacacctc GTTTGgtaagtatct cttgtttcagGTCGC ttcttcacagATGAG ... GTTGGgtgatctcaa GCCCGgtgagcatca ttctccgcagCCCAG tttcttttagCTTGG GCCCGgtgagcgaca TCACGgtaagtgagg ttccttccagCCTGG tctttcccagGTTCA TCACGgtgagtgagg TGAAGgtaggctccg ctccttccagGTCCA tgtcttccagTCTTA ... CCTCAgtaagtggcc CTTTGgtatgaatct tgtgtttcagATCAG ctctggacagAAAAC CTTTGgtaggactat TTGAGgtgagtagtg cccggggcagAGAAT TGGAGgtgagtgttg tgtcattcagGTGAC cctcctccagGTGGC TGCAGgtgagtgtgg TGCGGgtgagccggg ccctttacagCTCTG...
  • 10
  • 434
  • 0
Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Báo cáo khoa học: Bovine tryptases cDNA cloning, tissue specific expression and characterization of the lung isoform ppt

Ngày tải lên : 17/03/2014, 09:20
... undigested band, while in the BLCT insert the presence of the restriction site gives rise to two bands We took advantage of this different restriction pattern with NspI to evaluate the distribution ... TTCCCCCTGAAGCAGGTGAAGGTGCCCGTCGTGGAGAACAGTGTCTGTGACAGGAAGTACCACTCTGGCCTG 576 TCCACAGGGGACAACGTCCCCATCGTGCGGGAGGACATGCTGTGTGCTGGGGACAGCGGGAGGAACTTCTGC 648 CAGGGCGACTCTGGAGGGCCCCTGGTCTGCAAGGTGAATGGCACCTGGCTGCAGGCGGGGGTGGTCAGCTGG ... residue in that position results in a decrease negative charge at the bottom of the pocket and a consequent weaker interaction of substrates when compared with BLT and the other tryptases The usual...
  • 11
  • 527
  • 0
Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

Báo cáo khoa học: Expression of the Pycnoporus cinnabarinus laccase gene in Aspergillus niger and characterization of the recombinant enzyme pdf

Ngày tải lên : 17/03/2014, 11:20
... 90 Temperature (°C) 30 kDa Fig Effect of the temperature on the activity of the purified laccase Various temperatures in the range of 25 °C to 85 °C were tested with 500 lM ABTS as the substrate ... recombinant protein The optimal temperature varies in the range of 65–70 °C, and optimal pH is for both proteins In addition, the temperature stability was strictly identical, and the pH stability seems ... characteristics of the recombinant enzymes, i.e molecular mass, pI, optimal temperature and pH, stability to the temperature, N-terminal sequence and the Michaelis constant, were compared to those of the...
  • 8
  • 495
  • 0
Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

Báo cáo khoa học: Expression and characterization of the biofilm-related and carnosine-hydrolyzing aminoacylhistidine dipeptidase from Vibrio alginolyticus pot

Ngày tải lên : 23/03/2014, 06:20
... analyses demonstrated that PepD contains zinc as the divalent metal ion We then investigated the effect of metal ion substitutions on the enzymatic activity of the native PepD protein The native apo-PepD ... in the complete loss of enzymatic activity, except for the Glu149Asp and the Glu150Asp mutations The substitution of the glutamic acid to the aspartic acid with the same negative charge but one ... sp3-orbital substrate–enzyme tetrahedral intermediate, the electrostatic and steric effects between the catalytic water and the carbonyl carbon of the Glu149 changed when substituted with other amino...
  • 14
  • 303
  • 0