effects of dimensions on the sensitivity of a conducting polymer microwire sensor

... (i.e., the volume of the chamber) and the density of air at room temperature. The concentration of the methanol was calculated from the ratio between the mass of methanol and that of air inside the ... indicates how large the sensor response isto a particular concentration, and is used as a measure of the sensitivity of the corresponding sensor. Geometrically, the sensing area of a ﬁlm sensor ... two dimensions. However, the th ree relationships indicate that the effects of the three geometrical dimensions on the sensitivity of a microwire sensor vary with the conducting polymer materials...

Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf

... and recruitment and retention programs of the armed forces. Accurate data on the relationship between performance on the one hand and ability, experience, and training on the other would allow ... technician; ”technical” positions, including aviation machinist’s mate, aviation structural mechanic, aviation ordnanceman, aviation equipment support technician, and aviation survival equipmentman; ... ”mission capable” marginal product refers to the marginal product of an individual at the ”mission capable” level of readiness, defined as the ability to complete one and potentially all of the...

NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx

... Malaysia consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan. Kuala Lumpur, the national capital, Labuan UNEP/SCS – National ... central part of South-East Asia and occupies a total land area of 330,434 square kilometres. The land mass comprises three main components: Peninsular Malaysia and the two states of Sabah and Sarawak, ... The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges from a minimum of 25°C to a high of...

Báo cáo y học: "Effect of antibodies on the expression of Plasmodium falciparum circumsporozoite protein gene"

... falciparum 3D7 clone. Concentration of DNA was determined by spectrophotometric analysis of optical density at 260nm (GeneQuant, Pharmacia) and standard DNA solutions were prepared. A standard ... the mean number of parasites when treated with 1μg mAb/ml. Anti-CSP-mAb had contradictory effect depending on concentration and although mAb at lower concentration seems to have a stimulatory ... 2% parasitaemia (87-97 % ring stage parasites) and 5% heamatocrit and were cultured for 48 hours. Percentage of parasite increase/decrease was calculated by dividing parasitaemia of treated...

The Effect of Aesthetic on the Usability of Data Visualization pdf

... visualization technique with the lowest aggregate aesthetic rank, averaged the highest rate of task abandonment and was among the lowest in latency of erroneous response. More than half of all participants ... mean of aesthetic rank was calculated for each of the 11 visualizations, as illustrated in Figure 4. The confidence interval of .05% determined the validity and variance of each visualization ... investigated as a directly measurable and quantifiable entity, rather than the reflection of personal judgment. Within the graph drawing discipline, as well as in most of the data visualization...

Báo cáo khoa học: Effect of heliquinomycin on the activity of human minichromosome maintenance 4/6/7 helicase pdf

... displacement activity of replication protein A (RPA), and on the RNA priming and DNA poly-merization activities of the DNA polymerase -a/ primasecomplex. The results indicated that, among all the enzymes ... at an IC50value of 25 lm. The DNApolymerization activity of the DNA polymerase -a/ primase complex was measured using activated DNAas a template and a primer. The observed reduction in the ... and an average of the values was plotted together witherror bars. (B) Effect of increasing concentrations of heliquinomycin on the DNA polymerization activity of the DNA polymerase -a/ prim-ase....

Báo cáo khoa học: The inﬂuence of cholesterol on the interaction of HIV gp41 membrane proximal region-derived peptides with lipid bilayers potx

... which has a + 2 net formal charge, and the negatively charged lipid. For MPRP-I, the partitionconstant increase was not as high and in the case of MPRP-S the partition constant remained unchangedrelative ... presence of (a) MPRP-C, (b) MPRP-I and (c) MPRP-S. The spectra wereobtained by subtracting the excitation spectrum before the addition of peptides from the excitation spectra after addition of the ... ﬂuorescence quantum yield is dependent on the polarity of the microenvironment of the Trp resi-dues, as well as on the peptide conformation. Both areaffected upon insertion of the peptides in membranes.Additionally,...

RCUK Policy and Code of Conduct on the Governance of Good Research Conduct pptx

... appropriate.• The person against whom allegations are made should be given details of the allegations in writing, the nature of the evidence against them, and begiven reasonable time and opportunity ... each of the following:FabricationThis includes the creation of false data or other aspects of research, includingdocumentation and participant consent.FalsificationThis includes the inappropriate ... professionalbodies;• be drawn to the attention of all staff on appointment;• be easily available at all times in guidance manuals and on websites.Clear managerial arrangements• ROs should have published...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* ... effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan ... Structure and function of a regulated archaealtriosephosphate isomerase adapted to high temperature.J Mol Biol 342, 861–875.12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S,Balaram H, Balaram...

Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot

... NRG-5¢_forNRG-Beta_revTCTCCGGCGAGATGTCCGAGGCAGCGATCACCAGTAAAC677GAPDH GAPDH_forGAPDH_revGAAGGGCTCATGACCACAGTCCATTCATTGTCGTACCAGGAAATGAGCTT450Fig. 2. Proteolytical processing of APP and NRG-1 in U373 ... NRG-jD_forNRG-TM_revTGAAAGACCTTTCAAACCCCTCGTTTTGCAGTAGGCCACCACApproximately 200(depending on isoform)Immunoglobulin domain(type I and II)NRG-IG_forNRG-TM_revGCCAGGGAAGTCAGAACTTCGTTTTGCAGTAGGCCACCAC543Glycosylation ... coexpression of this enzyme [35]. Cleavage of the a2 isoform of NRG-1, on the other hand, wasimpaired in ﬁbroblasts with catalytically inactiveADAM17 [30].b- and c-secretase are responsible...

Xem thêm

Từ khóa: dynamic effects of a temporary increase in liquidity in the rest of the world on a small open oil exporter the gain or loss for the company on the transaction and a description of the functions and risks assumed in the transaction by each related party the gain generated or loss incurred by the company on the transaction and a description of the functions and risks assumed in the transaction by each related party an illustration of the effect of climate change on the oceanwave climate a stochastic model the more trips that are made by public transport reduces the number of trips that are made by private vehicles leading to less congestion on the roads and a more efficient road system experimental evaluation of the preventive and therapeutic effects of a moisturizer effects of a single low and high dose cyc on 5t2mm progression the health effects of a psychosocial work stressor on the transition to a higher degree of mechanization for each situation in brackets write a sentence with should or shouldn t one of the phrases in the box below go away for a few days go to bed so late look for another job put some pictures on the walls take a photograph use her car so much leftmost arc is the same arc as figure 9 12 with a startangle of 90 arc on the right has a modified bounding box fick s second law of diffusion equation 3 1 9 40 which is based on a one dimensional model that demonstrates the effect of diffusion on the concentration in a container as well as the rate at which the amoun click on the drop down arrow beneath the new slide button in the slides group on the home ribbon a menu with the different layout types of slides will appear 2surface energy and the wetting of a solid polymer surface antioxidant anticancer activity and other health effects of a nutritional supplement galaxy r Báo cáo quy trình mua hàng CT CP Công Nghệ NPV chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấp Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k means Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chế Thơ nôm tứ tuyệt trào phúng hồ xuân hương Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX Chuong 2 nhận dạng rui ro Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2 Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ