antioxidant anticancer activity and other health effects of a nutritional supplement galaxy r

Báo cáo y học: " Survivors of the war in the Northern Kosovo: violence exposure, risk factors and public health effects of an ethnic conflic" pdf

Báo cáo y học: " Survivors of the war in the Northern Kosovo: violence exposure, risk factors and public health effects of an ethnic conflic" pdf

Ngày tải lên : 13/08/2014, 14:20
... Kaiser R, Gotway CA, Ghitis F, Toomey E, Salama P: The mental health of expatriate and Kosovar Albanian humanitarian aid workers Disasters 2005, 29(2):152-170 20 World Health Organization: WHO report ... participation of an Albanian family could mean that family members are more likely to have been targets of the Serbian paramilitary or law Page 11 of 16 Table 4: Variables of lifetime exposure to organised ... for war survivors, although major events happened around 10 years ago, and a 10 year-recall is considered reliable among general populations without post-trauma stress disorder [36,37] Memory...
  • 16
  • 310
  • 0
báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

Ngày tải lên : 10/08/2014, 10:23
... for scoring the biomedical items in the abstraction instrument All available values over three years were obtained and afterwards a mean per patient per year was calculated Data abstractors were ... [16-19] at baseline, one year and two years follow up We extracted patient outcomes and professional performance data from medical records and patient survey, as well as data about structural aspects ... clinical practice were the appropriate assessment of glycemic and cardiovascular risk control Based on the medical record data abstraction (as already described), we determined whether at least...
  • 10
  • 295
  • 0
Báo cáo y học: "Child and Adolescent Psychiatry and Mental Health – development of a new open-access journal" ppt

Báo cáo y học: "Child and Adolescent Psychiatry and Mental Health – development of a new open-access journal" ppt

Ngày tải lên : 13/08/2014, 18:21
... views of the authors and are not to be construed as official or as reflecting the views of the Department of Health and Human Services, the National Institutes of Health, or the National Institute ... development for disseminating the results of biomedical researc h in our lifetime." Sir Paul Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community ... Child and Adolescent Psychiatry and Mental Health 2008, 2:22 http://www.capmh.com/content/2/1/22 and all readers We also have a special interest in case reports with reference to cultural backgrounds...
  • 2
  • 180
  • 0
RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt

RESPIRATORY HEALTH EFFECTS OF PASSIVE SMOKING: LUNG CANCER AND OTHER DISORDERS ppt

Ngày tải lên : 15/03/2014, 01:20
... Superfund (The Radon Gas and Indoor Air Quality Research Act of 1986) to provide information and guidance on the potential hazards of indoor air pollutants Two drafts of this report were made available ... under the direction of Kay Marshall, who were responsible for editing, word processing, and proofreading the final report Robert Flaak, Assistant Staff Director of the SAB, whose efforts and professionalism ... Chapter 3: Brian P Leaderer2 Chapter 4: Jennifer Jinot Chapters 5/6: Kenneth G Brown3 Chapter 7: Fernando D Martinez4 Chapter 8: Fernando D Martinez and Steven P Bayard Appendix A: Kenneth G Brown,...
  • 20
  • 377
  • 0
Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx

Ngày tải lên : 16/02/2014, 01:20
... higher risk in Gulf War veterans Those outcomes are cancer (particularly brain and testicular), ALS, birth defects (including Goldenhar syndrome and urinary tract abnormalities) and other adverse ... onset of cancer Incidence of and mortality from cancer in general and brain and testicular cancer in particular have been assessed in cohort studies An association of brain-cancer mortality with ... JAMES, Research Associate DAMIKA WEBB, Research Assistant RENEE WLODARCZYK, Intern NORMAN GROSSBLATT, Senior Editor ROSE MARIE MARTINEZ, Director, Board on Population Health and Public Health Practice...
  • 292
  • 574
  • 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Ngày tải lên : 18/02/2014, 11:20
... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W168F Y74W CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) ... 12 Gayathri P, Banerjee M, Vijayalakshmi A, Azeez S, Balaram H, Balaram P & Murthy MRN (2007) Structure of triosephosphate isomerase (TIM) from Methanocaldococcus jannaschii Acta Crystallogr D...
  • 15
  • 635
  • 0
Báo cáo khoa học: Anti- and pro-oxidant effects of quercetin in copper-induced low density lipoprotein oxidation Quercetin as an effective antioxidant against pro-oxidant effects of urate potx

Báo cáo khoa học: Anti- and pro-oxidant effects of quercetin in copper-induced low density lipoprotein oxidation Quercetin as an effective antioxidant against pro-oxidant effects of urate potx

Ngày tải lên : 23/03/2014, 12:20
... with reference chromatograms of freshly prepared standard urate solutions in the 1–20 lM range The concentration of urate in the samples was calculated from the peak area compared to that of standard ... antioxidant activity of quercetin Conversely, it may also reflect a pro-oxidant ability larger for quercetin than for urate, thus requiring lower concentrations to be observable As a matter of fact, at ... investigation appears sensible as it was recently demonstrated [36] that, at low concentration, urate may behave as a pro-oxidant Moreover, in an earlier report it was suggested that flavonoids and urate...
  • 9
  • 504
  • 0
The Health Effects of Air Pollution: Separating Science and Propaganda pptx

The Health Effects of Air Pollution: Separating Science and Propaganda pptx

Ngày tải lên : 29/03/2014, 18:20
... information on air pollution and health comes from environmental activists, regulators, and health researchers As we’ve seen, most of their claims of harm from air pollution are great exaggerations ... Summary | separating science and propaganda Americans are alarmed about air pollution, and no wonder Most of the information they receive about air pollution is alarming Activist groups issue reports ... environmental activists, regula� tors, and health researchers Most of their claims of harm from air pollution are great exaggerations or even outright fabrications in the donations that support their activism...
  • 22
  • 478
  • 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Ngày tải lên : 31/03/2014, 09:20
... hydrophobic, and tryptophan residues are colored black, gray, and dark gray, respectively The direction of view is approximately perpendicular to the helical axis in panels A and B, and is parallel to ... structural properties of the D16W-D24)37 GGN4, which are similar to those of other known amphipathic a helical antimicrobial peptides, are satisfactory for both the barrel-stave and the carpet-like ... backbone dihedral angle restraints, and hydrogen bond restraints were obtained and used for the structure calculation by the simulated annealing and energy minimization protocol in the program...
  • 8
  • 447
  • 0
Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Looking at the label and beyond: the effects of calorie labels, health consciousness, and demographics on caloric intake in restaurants

Ngày tải lên : 08/04/2014, 18:33
... medium-, and high-calorie diners Results We first compared the average number of entrée, extra, and total calories ordered across the three menu formats Figure reveals that, in terms of entrée calories, ... conducted the research and DD oversaw management of the restaurant BE had primary responsibility for analyzing the data and writing the paper, with all of the authors contributing by reviewing and editing ... demographic and attitudinal profiles were available Results from the larger data set showed the calorie+traffic light label leads to a nearly identical 68.7 calorie reduction (on average), a result...
  • 9
  • 420
  • 0
Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf

Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf

Ngày tải lên : 08/08/2014, 18:21
... Suggested ACKNOWLEDGMENTS The authors thank Prof Van Praag for having performed Ca, K and Mg quantitations in his laboratory, and Prof Dizengremel for allowing access to the facilities for measuring Rubisco ... (around 12 for Phaseolus, Barradas et al, 1994; 24 for Commelina communis, Vavasseur et al, 1984; 35 for Vicia faba, Ridolfi et al, 1994) Water stress, increased temperature and vapour pressure deficits ... was monitored on a leaf of three plants from each treatment A twig with six to eight leaves was cut under water, and after stabilisation of stomatal conductance, the shoot was transferred to a...
  • 11
  • 370
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 2 pptx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 2 pptx

Ngày tải lên : 11/08/2014, 13:22
... The recent observation that stream water, and also garden fertilizers, may be contaminated with perchlorate is an example Industrial and military operations and fireworks manufacturers use perchlorate ... the river by the city; discharge of large quantities of paint from a factory; oil dumping from Penn Central Railroad; and discharge of water at elevated temperatures from a nuclear power plant ... already suffering from respiratory disease One of these respiratory conditions was even referred to as ‘‘Yokohama and Kawasaki Asthma.’’34 FIGURE 2.2 Comparison of death rates for cancer of all sites...
  • 18
  • 424
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 3 ppsx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 3 ppsx

Ngày tải lên : 11/08/2014, 13:22
... disposal sites, and in many industrial areas Natural air may contain odors arising from a variety of sources Decomposition of protein-containing organic matter derived from vegetation and animals ... number of salmon and herring eggs and larvae While many scientists believed that a ected areas had recovered within a decade after the disaster, a new study by Short et al 11 at the Alaska Fisheries ... utero The total radioactivity of the material released from the reactor was estimated to be 200 times that of the combined releases from the atomic bombs dropped on Hiroshima and Nagasaki, according...
  • 13
  • 770
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 4 pptx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 4 pptx

Ngày tải lên : 11/08/2014, 13:22
... called a carrier, carries a water-soluble substance across the membrane active transport, which requires both a carrier and energy Of the four mechanisms, active transport is the only one where ... types of cancer, are attributable, at least partly, to free-radical-mediated reactions As free radicals react with the unsaturated fatty acids and cholesterol, such as those in cellular membranes, ... FREE-RADICAL-MEDIATED REACTIONS A free radical is any molecule with an odd number of electrons, and can occur as both organic and inorganic molecules Free radicals are highly reactive and therefore...
  • 20
  • 518
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 7 docx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 7 docx

Ngày tải lên : 11/08/2014, 13:22
... various protective properties; and large alveolar cells and alveolar macrophages carry out oxidative and synthetic processes that defend the lungs against invading organic and inorganic materials ... However, this can also lead to respiratory distress A very important feature of the trachea is the action of cilia, hair-like structures that beat rhythmically back and forth in the air passage ... lower bowels by toxic agents leads to loss of water, sodium (Na), and other vital minerals and vitamins 7.2.3 MEMBRANES The plasma and intracellular membranes of mammalian cells have similar overall...
  • 12
  • 310
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 8 pot

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 8 pot

Ngày tải lên : 11/08/2014, 13:22
... atmosphere However, free radicals formed from hydrocarbons (e.g., RO2 Á , where R represents a hydrocarbon group) and other species occurring in the urban atmosphere react with and remove NO, thus preventing ... include dryness of upper airway passages, irritation of mucous membranes of nose and throat, bronchial irritation, headache, fatigue, and alterations of visual response Evidence suggests that O3 ... unsaturated fatty acids as compared with saturated fatty acids, and the more unsaturated the fatty acids were, the greater the decrease observed Furthermore, in the rat a deficiency of vitamin...
  • 24
  • 347
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 12 pdf

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 12 pdf

Ngày tải lên : 11/08/2014, 13:22
... hazard in open oceans, in freshwaters and estuaries accumulation of Cd at abnormally high concentrations can occur as a result of natural or anthropogenic sources In natural freshwater, Cd usually ... humans and animals, Cd inhibits alkaline phosphatase and ATPases of myosin and pulmonary alveolar macrophage cells Cd appears capable of inhibiting Phase I and Phase II xenobiotic biotransformation ... chemical form of the Hg, and soil aeration Some plants have a barrier to the uptake and circulation of inorganic Hg salts and organically complexed mercurials adsorbed on clay, while others have...
  • 41
  • 495
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 13 doc

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 13 doc

Ngày tải lên : 11/08/2014, 13:22
... parathion and malathion, are derivatives of phosphoric acid, the carbamates are derivatives of carbamic acid (HO–CO–NH2) Carbamates are widely used for worm control on vegetables Examples of carbamates ... nausea, vomiting, diarrhea, cramps, sweating, salivation, blurred vision, and muscular tremors Severe cases may be fatal due to respiratory failure Even though organophosphates are usually more ... plants are complex After application, the chemicals are absorbed primarily through stomata and secondarily through root hairs with water In resistant species, PHs are detoxified by various decarboxylation...
  • 27
  • 417
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 15 pptx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 15 pptx

Ngày tải lên : 11/08/2014, 13:22
... CHROMOSOMAL ABERRATIONS A human cell normally has 23 pairs of autosomal chromosomes and a pair of sex chromosomes In chromosomal aberration, mutation produces either a change in the number of ... DNA helix Base-pairing errors due to incorporation mispairing Interference with spindle formation and disruption of migration and segregation of chromosomes Removal of an amino group (NH2) from ... scrap rubber tires, combustion of agricultural wastes (such as sugar cane, orchard prunings, and grain straws), municipal sewage sludges,4 herbicide such as S-(2-chloroallyl) diethyldithiocarbamate...
  • 10
  • 305
  • 0
Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 16 ppsx

Environmental Toxicology : Biological and Health Effects of Pollutants - Chapter 16 ppsx

Ngày tải lên : 11/08/2014, 13:22
... atmosphere, and surface and groundwater contamination resulting from sludge and wastewater discharge Vinyl chloride has been shown to be both mutagenic and carcinogenic It is classified as a Part carcinogen ... PAHs are, therefore, widely distributed in all parts of the environment – air, soil, water, and sediments They are of major concern because they represent a potential human health hazard through ... National Center for Health Statistics, 1997 American Cancer Society, Cancer Facts and Figures 2003, ACS, Atlanta, GA, 2003, p.4 U.S Department of Health and Human Services, The Surgeon General’s Report...
  • 16
  • 318
  • 0