the health effects of a psychosocial work stressor
báo cáo hóa học:" The PedsQL™ as a patient-reported outcome in children and adolescents with Attention-Deficit/Hyperactivity Disorder: a population-based study" pdf
... state, and national level [3-5] In addition, utilization of HRQOL measures at the population health level may assist in the evaluation of the healthcare needs of a community, and results can be ... an alpha of 0.90, recommended for individual patient analysis [40], making the Total Scale Score suitable as a summary score for the primary analysis of HRQOL outcome in population health analyses ... Hispanic/Latino, (9.7%) Black/African American, (9.7%) Asian/Pacific Islander, 2(2.8%) Native American or Native Alaskan, and (12.5%) missing The statewide SCHIP sample was representative of low-income...
- 10
- 538
- 0
Tài liệu Creative economy as a development strategy a view of developing countires doc
... relevant analysis on the creation of cultural brands and on the inequality in the sharing of generated benefits Sharada Ramanathan unveils a critical panorama of creative economy in India, merging the ... colors of African fabrics, of the ‘Costa cloths,’ as they used to be called in Brazil, the endless tonalities of the Indian saris, the masks and sculptures of Mali, of Burkina, of the Congo, of Gabon, ... products and services will be sent abroad.” On the other hand, Latin America and the Caribbean together did not exceed a 3% market share, whereas Australasia and Africa accounted for 1% of global exports...
- 266
- 436
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... 95 Halbert SA, Tam PY, Adams RJ, Blandau RJ: An analysis of the mechanisms of egg transport in the ampulla of the rabbit oviduct Gynecol Invest 1976, 7:306-320 96 Bourdage RJ, Halbert SA: Quantification...
- 17
- 733
- 0
Báo cáo khoa học: "Solving Relational Similarity Problems Using the Web as a Corpus" potx
... verbal analogy example, we build six feature vectors – one for each of the six word pairs We then calculate the relational similarity between the stem of the analogy and each of the five candidates, ... 2.3 Paraphrase Acquisition Our method of extraction of paraphrasing verbs and prepositions is similar to previous paraphrase acquisition approaches Lin and Pantel (2001) extract paraphrases from ... ignore modals and auxiliaries, and we lemmatize the verbs Preposition: If one of the target nouns is the head of an NP containing a PP with an internal NP headed by the other target noun (or an inflected...
- 9
- 390
- 0
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Shapley originally imagined mate search as analogous to applying to college The weakness of the analogy is that the set of American colleges is relatively small and stable, and information about most...
- 50
- 470
- 0
A Portrait of the Artist as a Young Man ppt
... mother had a nicer smell than his father She played on the piano the sailor’s hornpipe for him to dance He danced: Tralala lala, Tralala tralaladdy, Free eBooks at Planet eBook.com Tralala lala, ... had big voices and big boots and they studied trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again ... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed...
- 317
- 341
- 0
Báo cáo toán học: " Code choice in the Chinese as a foreign language classroom" pot
... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... for Teaching Chinese as a Foreign Language, a non-government and non-profit organization affiliated with the Ministry of Education of the People's Republic of China Samuel Ting was awarded the ... International Journal of Learning 17(6): 257-272 Wang, Danping 2012 (in press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers...
- 26
- 523
- 0
báo cáo hóa học:" Code choice in the Chinese as a foreign language classroom" pptx
... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... for Teaching Chinese as a Foreign Language, a non-government and non-profit organization affiliated with the Ministry of Education of the People's Republic of China Samuel Ting was awarded the ... International Journal of Learning 17(6): 257-272 Wang, Danping 2012 (in press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers...
- 26
- 501
- 0
Báo cáo hóa học: "Code choice in the Chinese as a foreign language classroom" potx
... Charlene, and Patricia Duff 1994 Teachers’ language use in university foreign language classrooms: A qualitative analysis of English and target language alternation The Modern Language Journal ... for Teaching Chinese as a Foreign Language, a non-government and non-profit organization affiliated with the Ministry of Education of the People's Republic of China Samuel Ting was awarded the ... International Journal of Learning 17(6): 257-272 Wang, Danping 2012 (in press) The use of English as a lingua franca in teaching Chinese as a foreign language: A case study of native Chinese teachers...
- 26
- 391
- 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx
... Gartside, Esq., of Manchester They are tenable for two years and about three are awarded each year They are open to males of British nationality who at the date of the election shall be over the ... a course that is already being adopted by the Southern at Bahia Blanca, and the Entre Rios line at Ibicuy There is also a new project floated for the construction of a large port in the Bay of ... canvas shoe factories and similar works Even the production of such essentially native goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the...
- 199
- 354
- 0
The Manager as a Planner and Strategist pdf
... market, Matsushita had to place more emphasis on local customization of its Panasonic and JVC brands The advantages and disadvantages of a multidomestic strategy are the opposite of those of a ... select appropriate goals and courses of action for an organization.4 The organizational plan that results from the planning process details the goals of the organization and specifies how managers ... form a strategic alliance with a local razor blade company and take a majority stake in it; invest in a large marketing campaign and then build a modern factory to make razor blades and other products...
- 38
- 526
- 0
Báo cáo khoa hoc:" The chicken as a model to study microchromosomes in birds: a review" potx
... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the ... S.E., Delany M.E., Muscarella D.E., Constant and variable features of the avian chromosomes, in: Etches R.J., Gibbins A. M.V (Eds.), Manipulation of the Avian Genome, CRC press, Guelph, Canada, 1993, ... standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian Karyotype, concerns eight pairs of macrochromosomes...
- 11
- 318
- 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding ... histological examination and was a major contributor in writing the manuscript All authors read and approved the final manuscript Competing interests The authors declare that they have no competing...
- 4
- 233
- 0
Báo cáo y học: "Menstruating from the umbilicus as a rare case of primary umbilical endometriosis: a case report" pot
... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of these ... presence of endometriotic glands with mucinous type metaplasia and extravasation of the mucinous secretion into the adjacent stroma (Figure 1) No epithelial atypia was seen and the excision appeared ... deliveries and had no history of abdominal pain, dyspareunia or infertility She was not using any form of hormonal contraception Her medical history was not significant and she never had any abdominal...
- 3
- 383
- 0
báo cáo khoa học:" The ICF as a common language for rehabilitation goal-setting: comparing client and professional priorities" ppt
... across the nine ICF activities and participation domains The Friedman analysis is a nonparametric statistical test which is an alternative to the repeated analysis of variance measure Statistical ... authors state that a lack of conceptual clarity exists between the concept of activity and the concept of participation as operationalized within the ICF, and argue that certain of the domains are ... its design, statistical analysis and drafted the manuscript MG and AVDM participated in its design, data collection and statistical analysis All authors read and approved the final manuscript Competing...
- 9
- 323
- 0
Báo cáo y học: "Genomic studies of mood disorders - the brain as a muscle" pot
... pharmacotherapy and psychotherapy, with a treadmill supplanting the proverbial Freudian couch The Romans may have had it right with their ideal of mens sana in corpore sano (a healthy mind in a ... Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and serum of schizophrenic patients Mol ... state and leaves open the possibility that the opposite may be true that FGFs may be increased - in more manic states, giving an overall mixed picture in brains from bipolar patients As a caveat,...
- 4
- 161
- 0
slike bài giảng ứng dụng xây dựng hệ thống thông tin chương 3 the analyst as a project manager
... Learning Objectives Explain the elements of project management and the responsibilities of a project manager Explain project initiation and the activities in the project planning phase of the ... 17 Activities of the Project Planning Phase Systems Analysis and Design in a Changing World, 3rd Edition 18 Activities of the Project Planning Phase and Their Key Questions Systems Analysis and ... preliminary research on alternative solutions Barbara, Steve and William McDougal: Proceed with analysis before making solution decisions Barbara, Steve: Began schedule, budget, feasibility statement...
- 40
- 310
- 0
luận văn Toxicity assessment of small molecules using the zebrafish as a model system
... CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified using the SensiMix SYBR Hi-ROX Kit (Bioline; Meridian Life Science) and the reaction ... the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their speed decreased as they adapted to darkness The habituation ... compare all median values of larval velocity and activity All significant effects of chemicals on larval locomotion are shown in Figure 3.6 Figure 3.6: Comparative analysis of larval activity Bars...
- 58
- 262
- 0
The Stockmarket as a Sourc of Finance
... (1964), Grabowski and Mueller (1972) and others are examples of the managerial capitalismapproach The agencycost approachfocusseson contractingaspectswithinthe overall frameworkof the principal-agent ... in the managerial theory of investment Managerial theory of investment The managerial approach to corporate behavior directly challenges the assumption of profit maximization by the firm and ... though the information-theoreticapproach assumes the prevalence of capital market constraints and financing hierarchy, it is cast in a neoclassical framework with the usual assumption that managers...
- 52
- 325
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose