Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
... 138tctgtttcagATCAG CTTTGgtatgaatct 17 3067 1 Human 17 138tgtgtttcagATCAG CTTTGgtaggactat 17 1806 1Mouse 18 182ctctggacagAAAAC TTGAGgtgagtagtg 18 838 0 Human 18 182cccggggcagAGAAT TGGAGgtgagtgttg ... 180tgttcctcagGCATC CCCAGgtgatacctc 9 202 1 Human 9 180ccgacctcagGCCTC CATAGgtgacacctc 9 145 1Mouse 10 117ctctttgcagGTTGG GTTTGgtaagtatct 10 681 1 Human 10 114/126dcttgtttcagGTCGC GTTGGgtgatctcaa 10 ... 165atgtgctcagTTCAC ATCAGgtgagccttt 5 1629 0Mouse 6 156 cctttcctagGAATA TTGGGgtgagtggat 6 1102 0 Human 6 156cctttcctagGAATA TCGGGgtgagtagac 6 1063 0Mouse 7 131caacttccagACCAA TCCAGgtaagatcgg...
- 10
- 434
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
... RAMIGantibody at 37 °C, for 30 min. The cells were then fixedwith formaldehyde, b locked with isotype control antibody and stained with the fluorescent antibody against the otherprotein, on ice. The ... & Dautry-Varsat, A. (1995) Endocytosis of interleukin 2 receptors in human T l ymphocytes: distinct intracellular localization and fate of the receptor alpha, beta, and gamma chains. J. Cell ... Ôraft-mediated traffickingÕ.Compartmentation of the IL-2R chains by rafts in thesecells may also assist in setting up the proper conformation of heterotrimer IL-2R and its association with further...
- 10
- 499
- 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt
... of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAAAGATGTCCTAGCAATGTAATCGTCTATGACGTT),2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTGGCACTGGTAGAATTCGGC), 3 (TGCCGAATTCTACCAGTGCCAGTGAAGGACATCTTTGCCCACGTTGACCC), ... protein. The results suggest that the m odified pin in uences the a bility tobind duplex DNA and is consistent with observations byIngleston et al. [12] showing that mutations in EcRuvA thatreduce ... reflected in the highconservation of the sequences forming the pin in th emajority of bacteria with the exception of two Mycoplasmaspecies and one of Ureaplasma. In t he RuvA p roteins fromthese...
- 9
- 542
- 0
Báo cáo Y học: Domain organization, folding and stability of bacteriophage T4 fibritin, a segmented coiled-coil protein docx
... wasobserved. The assignment of the 330 K transition is evidentfrom the loss of a helicity at this temperature and changes in the magnitude of the accompanying enthalpy. The ratio o f the van t Hoff enthalpy ... The singularity a nd pro-portionality of that transition are consistent with the thermal unfolding of a uniform do main. By varying the ionic strength of the sample buffer, no discrete melting ... molecules. The C -terminal domain has the highest me lting temper-ature a nd it melts independently from all the other regions.Due to its trimeric nature, the midpoint temperature of the C-terminal...
- 9
- 366
- 0
Báo cáo Y học: Isolation, enzymatic properties, and mode of action of an exo-1,3-b-glucanase from Trichoderma viride doc
... cellooligosaccharides and p-nitrophenylb-glucopyranoside.Subsite stucture of the active centerFor determination of the active center subsite structure the kinetic parameters Km and Vmax of the hydrolytic ... important thing isregularity of a value for the intrinsic rate constant Kint.Accordingly, the substrate binding affinity becomes the sum of the affinities for glucose residues of the substrateaccessible ... estimation of affinities and number of subsites in the active center of the enzyme.According to this theory the kinetic parameters can beexpressed in a unified way in terms of subsite affinities Ai of m...
- 9
- 554
- 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... ribozyme in Mn2+is that binding of the cosubstrate to its site induces a conformationalchange in the RNA that inhibits Mn2+binding atanother inhibitory site(s). It may be relevant that in vitro-evolved ... ground-state structure of InDGbis that the ribozyme might undergo a transient internalization of P7, J8 ⁄ 7 and J6 ⁄ 7 after binding GMP to start the reaction. Binding of the guanosine nucleotide by the Tt.LSU ... isnoteworthy that neomycin inhibits the T4 .td intron bybinding at the G binding site and displacing one ortwo critical Mg2+ions [48]. We propose that the lack of Pb2+cleavage, and the apparent...
- 14
- 480
- 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf
... of the eRF1 mutants stimulated eRF3GTPase activity nearly identically to that of the wild-type protein (Table S2). These results indicate that the C-domain is able to change the efficiency of ... results of the GTPaseassays, which showed that mutations in the minido-main of eRF1 did not change the GTPase activity of eRF3. The minidomain in the crystal structure is near the N-terminal ... The amount of released [35S]Met-containing tetra-peptide, which indicated the efficiency of peptidyl-tRNAhydrolysis, was determined by scintillation counting of the supernatants using an Intertechnique...
- 17
- 490
- 0
Báo cáo khóa học: Metal-binding stoichiometry and selectivity of the copper chaperone CopZ from Enterococcus hirae pot
... (5¢-GGGCCGGCGGCCATGGCTAAACAGGAATTCTCGGTTAAAGGTATGTCTTGCAAC-3¢); copz-ap2, (5¢-GATACGACCAACAGCTTCTTCGATACGAGCAACGCAGTGGTTGCAAGACATACCTTTAAC-3¢); copz-p3, (5¢-GAAGCTGTTGGTCGTATCTCTGGTGTTAAAAAAGTTAAAGTTCAGCTGAAGAAAGAAAAG-3¢); ... wasestablished within 2 min of the addition of the metal. The data corresponding to the titration of EhCopZ withcadmium were fitted using either the binding isotherm or aScatchard plot. In the ... present in the solution with the metalcenter could greatly in uence the stoichiometry by changing the form of the complex. As these compounds can competewith the protein to bind the metal ion, their...
- 11
- 307
- 0
Báo cáo Y học: ATP stimulates MDM2-mediated inhibition of the DNA-binding function of E2F1 pot
... Geldanamycin and 17-allylamino demethoxygeldanamycin that target the nucleotide-binding site of HSP90 can alter the activity of the protein, change its conformation, and sensitizecells to death ... MDM2 to drive ubiqui-tination of p53: a coordinated interaction of the N-ter-minus of MDM2 with the N-terminus of p53, and aninteraction of the acid domain of MDM2 with the central domain of ... extend and analyse the role of the ATP-binding domain of MDM2with respect to its ability to function as a protein fold-ing factor for another key target protein, E2F1, in order to determine...
- 12
- 507
- 0
Báo cáo Y học: Novel regulatory regions found downstream of the rat B29/Ig-b gene docx
... resulted compared with the activity of the SV-40promoter alone. The region containing +4.4a to +4.6bshowed twice the activity of the SV-P control and essentially the same as that of the SV-40 enhancer ... protected by Y3 nuclearextract in which the consensus binding site for the OCTfamily was present. Deletion of the footprinted regionreduced enhancing activity to t hat of the B29/Ig-b promoteralone. ... member of the OCT family [29] appearedto be involved in the transactivation of the + 4.4a region,which had the highest enhancing activity of the threeconserved DHS. The binding site for the OCT...
- 10
- 332
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenstrengths and weaknesses of the case study method in psychologyreasons and origins of the civil rights movement in the usastrengths and weaknesses of the nature nurture debate in psychologyformulation process and storage conditions in the attainment enhancement and maintenance of the crispy crunchy character in wet dry and crusted food productsisolation and characterization of resident mesenchymal stem cells in human glomeruliorganization 2012 b ico composite and group indicator prices and average of the 2nd 3rd positions in london and new york futures markets the international coffee organization website http www ico org historical 2000 pdf hist prices pdf 01 03 2012the meaning and structure of the text acid precipitation a human impact on the earth systemto a test in general and description of the final test used in the studyk nonami t nakao a harada a kurokawa t sugiyama s fujitsuka n shimomura y hutson sm harris ra takagi h 1996 the valine catabolic pathway in human liver effect of cirrhosis on enzyme activities hepatology 24 1395 1398báo cáo khoa học y họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)