Unusual metal specificity and structure of the group I ribozyme from Chlamydomonas reinhardtii 23S rRNA Tai-Chih Kuo1, Obed W Odom2 and David L Herrin2 Department of Biochemistry, Tapei Medical University, Taiwan Section of Molecular Cell and Developmental Biology and Institute for Cellular and Molecular Biology, University of Texas, Austin, TX, USA Keywords Fe2+–EDTA; group I intron; Mn2+; RNA structure; RNA–metal interactions Correspondence D L Herrin, Section of Molecular Cell and Developmental Biology, University Station A6700, University of Texas at Austin, Austin, TX 78712, USA Fax: +1 512 4713843 Tel: +1 512 4713843 E-mail: herrin@mail.utexas.edu Website: http://www.biosci.utexas.edu/ MCDB/ (Received February 2006, revised April 2006, accepted 12 April 2006) doi:10.1111/j.1742-4658.2006.05280.x Group I intron ribozymes require cations for folding and catalysis, and the current literature indicates that a number of cations can promote folding, but only Mg2+ and Mn2+ support both processes However, some group I introns are active only with Mg2+, e.g three of the five group I introns in Chlamydomonas reinhardtii We have investigated one of these ribozymes, an intron from the 23S LSU rRNA gene of Chlamydomonas reinhardtii (Cr.LSU), by determining if the inhibition by Mn2+ involves catalysis, folding, or both Kinetic analysis of guanosine-dependent cleavage by a Cr.LSU ribozyme, 23S.5DGb, that lacks the 3¢ exon and intron-terminal G shows that Mn2+ does not affect guanosine binding or catalysis, but instead promotes misfolding of the ribozyme Surprisingly, ribozyme misfolding induced by Mn2+ is highly cooperative, with a Hill coefficient larger than that of native folding induced by Mg2+ At lower Mn2+ concentrations, metal inhibition is largely alleviated by the guanosine cosubstrate (GMP) The concentration dependence of guanosine cosubstrate-induced folding suggests that it functions by interacting with the G binding site, perhaps by displacing an inhibitory Mn2+ Because of these and other properties of Cr.LSU, the tertiary structure of the intron from 23S.5DGb was examined using Fe2+-EDTA cleavage The ground-state structure shows evidence of an unusually open ribozyme core: the catalytic P3–P7 domain and the nucleotides that connect it to the P4–P5–P6 domain are exposed to solvent The implications of this structure for the in vitro and in vivo properties of this intron ribozyme are discussed Group I introns are cis-acting ribozymes whose substrates (5¢ and 3¢ splice sites) are attached intramolecularly These introns have conserved uridine and guanosine nucleotides at the ends of the 5¢ exon and intron segments, respectively Although sequence conservation of group I introns is poor, their folded forms share a common core structure composed of two stacked-helix domains (P5–P4–P6 and P7–P3–P8) [1,2] Group I introns can be differentiated into five major subgroups (IA, IB, IC, ID, and IE) with further subdivisions that depend on the presence of peripheral domains that stabilize the core [3,4] Studies of several group I ribozymes, but especially the intron from the large rRNA gene of Tetrahymena thermophila (Tt.LSU), indicate that some domains are modular, and that the catalytic site is buried inside the folded ribozyme [5–7] The tertiary structure is stabilized by domain–domain interactions, such as hydrogen bonding of loop–receptor pairs, base triples, and pseudoknots [1,2] The group I self-splicing pathway consists of two consecutive transesterification reactions with the activated phosphodiesters at the splice sites First, the 3¢-OH of an exogenous guanosine nucleotide (GTP) Abbreviations Cr.LSU, intron from the 23S LSU rRNA gene of Chlamydomonas reinhardtii; oligo, oligodeoxynucleotide; Tt.LSU, intron from the large rRNA gene of Tetrahymena thermophila FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2631 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al attacks the 5¢ splice site (G-dependent cleavage), generating 5¢ exon and intron-3¢ exon intermediates Then, the 3¢-OH of the 5¢ exon attacks the 3¢ splice site, forming ligated exons and a free intron [9] The liberated intron can react with itself, forming a circular RNA [9], or with another RNA [10], via the 3¢-terminal G (XG) of the intron; it can attack a phosphodiester that becomes properly positioned in the catalytic center [9,10] Owing to the complexity of the ribozyme reactions and the polyanionic nature of RNA, the catalytic chemistry and folding of group I ribozymes (and other large ribozymes) require divalent metals [11,12] Whereas only Mg2+ and Mn2+ are able to support the chemistry of the Tetrahymena ribozyme [13], several divalent cations (e.g Mg2+, Mn2+, Ca2+, Sr2+, and Ba2+) [14], and even monovalent cations [15], are able to promote the formation of a native, or native-like, structure With divalent and monovalent salts as the only aids to RNA folding, however, the formation of alternative, nonproductive base pairs can trap a fraction of a large ribozyme in inactive conformations [16–18] The conversion of these forms into an active ribozyme is sometimes hampered, ironically, by native domain–domain interactions or high Mg2+ concentrations [19] Thus, in vivo, the folding of most large ribozymes is probably assisted by proteins In a few cases, it has been shown that in the presence of the proper protein, group I ribozymes that would otherwise be inactive, or become active only at high temperatures and high Mg2+ concentrations, perform catalysis in vitro under mild conditions [20,21] We have been studying the group I ribozyme, Cr.LSU, from the chloroplast 23S (LSU) rRNA gene of the green alga Chlamydomonas reinhardtii [22–24] Splicing of Cr.LSU in vivo is required for ribosome formation, and could be a limiting step in ribosome biogenesis, as it is one of the slowest steps in rRNA maturation [24] This subgroup IA3 intron self-splices efficiently in vitro, but requires higher Mg2+ concentrations than the model intron, Tt.LSU, and it is more sensitive to nucleotide substitutions in the core [23,25] Kinetic analysis indicated that a Cr.LSU pre-RNA containing the full-length intron and relatively long exon sequences tends to misfold in vitro, although the active fraction self-spliced rapidly [18] Self-splicing of Cr.LSU occurs only with Mg2+, and is inhibited by equivalent concentrations of Ca2+ or Mn2+ [26] The Mn2+ inhibition was unexpected, because Mn2+ is similar to Mg2+ [27,28], and has been shown to support the activity of group I and other large and small ribozymes [27,29,30] Thus, this group I intron exhibits several properties that distinguish it from the more well-studied Tt.LSU and phage introns 2632 We wished to know whether Mn2+ inhibits the formation of active Cr.LSU or whether it interferes with catalysis, and have addressed this question using ribozyme kinetics We also wanted to probe the folding and tertiary structure of the ribozyme using Fe2+EDTA, which promotes cleavage of the sugar–phosphate backbone, and can determine, for example, if the active site of Cr.LSU is internalized like those of other group I ribozymes [7,31] The wild-type Cr.LSU intron was unsuitable for this, because of its large size (888 nucleotides) Moreover, high concentrations of NH4+ and Mg2+ were required for efficient self-splicing of the large 23S.1 precursor [23] Hence, a smaller RNA, 23S.5 (448 nucleotides), in which the intron was shortened by replacing the long P6 extension (which encodes the I-CreI endonuclease [32]) with a short stem–loop, and the exons were reduced, was generated This pre-RNA self-splices efficiently without monovalent salt, and approximately 85% of the RNA is of the same kinetic competence (kcat ¼ min)1 and K1/2G ¼ 26 lm) [18] For this study, we have taken the 23S.5 pre-RNA and generated a ribozyme, 23S.5DGb, that performs GMP cleavage at the 5¢ splice site, but not exon ligation or intron circularization, as it lacks the 3¢ exon and the XG This RNA was used to assay ribozyme activity, and to generate end-labeled RNA for structural probing Results Inhibition of self-splicing and G-dependent cleavage by Mn2+ In splicing reactions with 23S.5 pre-RNA, substituting part (> ⁄ 3) of the Mg2+ with Mn2+ reduced the amount of products, which were undetectable when Mn2+ was the only divalent cation (not shown [26]) Varying the Mn2+ concentration (0.1–50 mm), pH (5.5–7.5), monovalent salt, temperature (37 or 47 °C), and reaction time (0.25–60 min) also did not yield any splicing products (data not shown) Mn2+ inhibits selfsplicing of the 23S.3 and 23S.4 pre-RNAs, which have different lengths of 5¢ exon [23], and it inhibits a transreaction [10] that involves the free intron reacting with 5.8S rRNA (not shown) Together, these data suggested that inhibition by Mn2+ probably involved the core ribozyme, and not the intron open reading frame (ORF) or exon sequences 23S.5DGb pre-RNA is a truncated version of 23S.5 that terminates nucleotides before the end of the intron (Fig 1A; see Fig 5D for the intron sequence and structure) Core catalytic activity is preserved, however, in the form of G-dependent cleavage at the FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al Ct 1.5 10 25 60 1.5 10 20 40 60 Fig Mn2+ inhibits the activity of the 23S.5DGb ribozyme (A) Schematic diagram of 23S.5DGb pre-RNA and the reaction being assayed 23S.5DGb pre-RNA contains a partial 5¢ exon (rectangle) and a shortened Cr.LSU intron (line), which lacks the large P6 extension and the last three nucleotides (AU XG) of the intron The sizes of the intron (InDGb) and 5¢ exon (5E) are indicated The arrow indicates cleavage of the pre-RNA at the 5¢ splice site by GMPG* (B, C) G-dependent cleavage reactions with mM (B) or 10 mM (C) MnCl2 The reactions with 32P-labeled 23S.5DGb pre-RNA (Pre) included 25 mM MgCl2 and 150 lM GMP The large product, InDGb, was separated on a denaturing gel and phosphorimaged (D) Quantification of 23S.5DGb pre-RNA decay in the presence (10 mM) or absence (0 mM) of Mn2+, and either 20 or 150 lM GMP The GMP cleavage reactions were performed as in (B) and (C), except at two different concentrations of GMP The %23S.5DGb pre-RNA remaining was measured, and the data fitted to an equation for twophase, exponential decay kinetics (see Experimental procedures) 5¢ splice site Incubation of 23S.5DGb with saturating Mg2+ (25 mm) and GMP (150 lm) produces the InDGb and 5¢ exon (not shown) molecules as expected (Fig 1B) In the presence of 10 mm Mn2+, however, less of the pre-RNA reacts (compare Fig 1B,C) Thus, the inhibition of 23S.5 self-splicing by Mn2+ is recapitulated by the G-dependent cleavage of 23S.5DGb preRNA Mixed-metal titrations over a range of total metal concentrations showed that the ratio of the two metals is somewhat more important than the absolute concentrations; a ratio of Mn2+ ⁄ Mg2+ of approximately : or higher inhibited G-dependent cleavage of 23S.5DGb RNA (and self-splicing of 23S.5, not shown) Quantification of time-course reactions similar to those in Fig 1B,C, except at two different GMP concentrations (Fig 1D), show that approximately 85% of the 23S.5DGb RNA is kinetically homogeneous and highly active (kobs approximately 0.9 min)1 at 150 lm GMP) The remaining fraction (approximately 15%) is relatively inactive, reacting 20–30 times more slowly (kobs ¼ 0.032 min)1 at 150 lm GMP, and 0.017 min)1 at 20 lm GMP) It can also be inferred from Fig 1D that the inactive RNA fraction increases substantially when 10 mm Mn2+ is added, from 15% to 32% at 150 lm GMP, or 50% at 20 lm GMP The inverse is true for the active fraction, which decreased from 85% to 68% and 50%, respectively The observed rate of G-dependent cleavage by the active fraction is not substantially affected by Mn2+: the kobs at 150 lm GMP is 0.96 min)1 with Mn2+ and 0.87 min)1 without it, and at 20 lm GMP, the kobs is 0.49 min)1 with Mn2+ and 0.55 min)1 without it We conclude that Mn2+ increases the proportion of 23S.5DGb pre-RNA that is inactive, whereas GMP increases the proportion that is active An extensive kinetic analysis was performed at 5–300 lm GMP and 10 or 15 mm Mn2+ in the presence of 25 mm Mg2+ Figure 2A shows that Mn2+ has little or no effect on the KG1/2 or kcat for the active fraction of the ribozyme However, as Fig 2B shows quite dramatically, the metal decreases the size of this fraction It should be noted that the proportion of active ribozyme without Mn2+ is approximately 88% at all GMP concentrations tested In the presence of 10 mm Mn2+, the maximum size of this fraction is 66% (> 100 lm GMP), and it decreases dramatically at GMP concentrations < 100 lm (Fig 2B) At 15 mm Mn2+, the percentage of active ribozyme is even lower (approximately 30% at > 25 lm GMP) and it decreases further at GMP < 20 lm These data extend the above result, and support the conclusion that Mn2+ affects mainly the correct folding of the ribozyme The FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2633 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al GMP concentration (K1/2G ¼ 60 lm and kcat ¼ 0.035 min)1, not shown) However, the inactive fraction in Mn2+ (10 mm in Fig 2B) reacts much more slowly (approximately 0.007 min)1) and independently of the GMP concentration (not shown) This result suggests that Mn2+ induces a distinctive slow-reacting fraction that must go through a rate-limiting conformational change before it can bind GMP and catalyze cleavage Model for the effect of Mn2+ on the 23S.5DGb ribozyme Since Mn2+ does not substantially affect the kinetic parameters for the active ribozyme, but instead reduces the size of this fraction, the following scheme (Scheme 1) is proposed to describe the inhibition of G-dependent cleavage by the metal ion ( U ỵ nMg2ỵ + pre-RNAnMg2ỵ active 2ỵ ( U ỵ mMn + pre-RNAmMn2ỵ inactive Fig Ribozyme activity at varying GMP and fixed Mn2+ concentrations The G-dependent cleavage reactions were performed at different concentrations of GMP (0–300 lM) and Mn2+ (0, 10 or 15 mM) in the presence of 25 mM MgCl2 The reactions were analyzed as described in Experimental procedures, and the observed rate constants (A) and percentages (B) of active ribozyme were plotted versus GMP concentration In (A), the line was fitted using the mM Mn2+ data In (B), the kcat values are 1.1, 1.0 and 1.0 min)1, respectively, for the reactions at 0, 10 and 15 mM Mn2+, and the corresponding KG1/2 values are 22, 24 and 21 lM, respectively results also show that most of the inhibition by 10 mm Mn2+ is reversed by saturating GMP (Fig 2B) Moreover, the fact that this GMP activation curve is similar to the GMP cleavage plot (Fig 2A) indicates that GMP is promoting ribozyme folding via the G binding site in P7 The rate of G-dependent cleavage by the inactive fraction that forms in Mg2+ increases slowly with 2634 Scheme U is unfolded 23S.5DGb pre-RNA, and the binding of a minimum of n Mg2+ ions leads to formation of the active complex, whereas binding of a minimum of m Mn2+ ions forms the inactive complex The sizes of the active and inactive fractions are the result of competitive metal binding to RNA The values of n and m are estimated from Hill analysis of G-dependent cleavage of 23S.5DGb It should be noted that Scheme indicates only the initial and final states of the preRNA; it does not invoke or rule out any misfolded intermediates that might form To determine n, G-dependent cleavage of 23S.5DGb was analyzed at varying MgCl2 concentrations (0–50 mm) and either or 12 mm MnCl2 (plus saturating GMP) Figure 3A shows that in the presence of Mn2+, a much higher concentration of Mg2+ is required to form the same amount of cleavage product (InDGb) A quantitative analysis of similar experiments (Fig 3B), but using 0–100 mm Mg2+ and several fixed Mn2+ concentrations (0, 7, 12 and 17 mm), reveals that cleavage increases cooperatively with increasing Mg2+, in the absence or presence of Mn2+ The midpoint of the Mg2+ titration curve in the absence of Mn2+ is approximately 4.5 mm, and nearly full activity is reached by 10 mm Mg2+ Hill analysis of the data gives n-values of 2.6, 2.2, 2.7 and 2.7, for reactions in 0, 7, 12 and 17 mm Mn2+, respectively These results indicate that formation of the active RNA–Mg2+ complex involves the binding of at least three Mg2+ ions by the ribozyme The data also show that Mg2+ can completely block the inhibition caused by Mn2+ FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al Fig Mg2+ dependence of ribozyme activity at fixed Mn2+ concentrations (A) G-dependent cleavage of 23S.5DGb pre-RNA at varying Mg2+ concentration, and mM (top) or 12 mM (bottom) MnCl2; the reactions also contained 150 lM GMP, and were incubated for 40 s They were separated on a denaturing polyacrylamide gel, which was phosphorimaged (B) Mg2+ concentration curves at fixed Mn2+ concentrations G-dependent cleavage of 23S.5DGb was performed as in (A), except for using the indicated Mn2+ concentrations The cleavage product (InDGb) was quantified, and expressed as a percentage of total RNA [Relative InDGb (%)] The data were curve-fitted to obtain Hill coefficients as described in Experimental procedures To determine the minimal number of Mn2+ involved in forming the inactive RNA–metal complex, G-dependent cleavage reactions were performed at varying Mn2+ and fixed Mg2+ concentrations Figure 4A shows representative gels of reactions that were performed at varying (0–30 mm) MnCl2 concentrations and either 15 or 25 mm MgCl2 The Fig Mn2+ dependence of ribozyme inhibition at fixed Mg2+ concentrations G-dependent cleavage of 23S.5DGb pre-RNA was performed with the indicated concentrations of MnCl2 (0–30 mM), 10 or 25 mM MgCl2, and 150 lM GMP for 40 s The reactions were analyzed as in Fig GMP-dependent cleavage decreases sharply above and mm MnCl2, respectively Quantitative analysis (Fig 4B) gives a Hill value (m) of 5.7 for the experiments with 15 and 25 mm MgCl2 Thus, formation of the inactive ribozyme is highly cooperative The data also suggest that binding of a minimum of six Mn2+ ions is involved in the misfolding that forms the inactive ribozyme Structure of the Cr.LSU intron in the 23S.5DGb pre-RNA The unusual metal specificity, as well as other atypical features of Cr.LSU (see Discussion), led us to study the global tertiary structure of the intron using FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2635 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al hydroxyl radical cleavage This analysis was carried out by incubating end-labeled, Mg2+-folded intron (InDGb) with Fe2+-EDTA [7,8] It should be emphasized that the RNA structure revealed by Fe2+-EDTA is an averaged image of the RNA molecules in solution However, since the kinetic data indicate that 85– 90% of 23S.5DGb pre-RNA is functionally similar, we assume that the predominant signal in the protection pattern is from active ribozyme Figure 5A shows an Fe2+-EDTA cleavage analysis performed at 0–25 mm Mg2+ In the absence of Mg2+ (lanes and 12), cleavage occurs throughout the molecule; this profile was defined as background As the Mg2+ concentration increased, different regions of the RNA became either more sensitive to, or more protected from, cleavage or cleavage was relatively unchanged Figure 5A shows that the overall cleavage profile changes gradually with Mg2+, a trend that appears to hold for most nucleotide positions (solid and open bars in Fig 5A, lanes 2–11) It should be noted, however, that the degree of change at some nucleotides, such as the protection of P3¢ (Fig 5A), appears to be greater at the higher concentrations of Mg2+ (> or mm), suggesting that this region may have a higher Mg2+ requirement for folding There is also a general increase in the amplitudes of the cleavage ⁄ protection peaks at the highest (25 mm) Mg2+ concentration tested A similar result is apparent in some of the Tt.LSU L-21 ScaI protection data [33], and may reflect a greater overall stability of the RNA at high Mg2+ Since 23S.5DGb pre-RNA is fully active at 25 mm Mg2+, we inferred the native structure of the ribozyme by comparing the cleavage profiles at and 25 mm Mg2+ (Fig 5B) For those nucleotides that showed differential cleavage, the extent of the difference was 2–4-fold at most positions; Fig 5C is the difference profile (for and 25 mm Mg2+) plotted by nucleotide position It should be noted that similar results were obtained when cleavage time, or concentration of Fe2+-EDTA, was varied over a four-fold range, or when dithiothreitol was replaced by ascorbate and hydrogen peroxide (not shown) To better visualize the locations of exposed and protected regions of the InDGb intron, data from the difference plot were converted to a color palette and mapped onto the proposed secondary structure (Fig 5D) Focusing on the critical P7–P3–P8 domain, the 5¢ strand of P7, which includes the G-binding site, is cleaved, whereas the 3¢ strand is protected The 3¢ strand of P3 is also protected, but the 5¢ strand is neither protected nor particularly exposed The part of J8 ⁄ proximal to P8 is protected, whereas the residues close to P7 are strongly cleaved; also, P8 itself is protected, but L8 is not For the P9 subdomains, most of P9 is protected, but most of P9.1 is neutral The 5¢ strand of P9.0 is protected despite the absence of the 3¢ strand For the idiosyncratic P7.1 and P7.2 domains, the helices are weakly protected, except for the 3¢ strand of P7.2, which is strongly protected, and both loops are cleaved For the other major stacked-helix domain, P5–P4–P6, as well as P2, the extent of protection or exposure was mostly neutral or relatively weak compared with the P7–P3–P8 domain However, P5, P6 and minor parts of P5a and P6a are protected Also, J4 ⁄ is weakly protected, but J5 ⁄ is weakly cleaved Of particular significance is the observed cleavage of J6 ⁄ and the neutrality of J3 ⁄ 4; these joining segments link the two major domains and form base triples with P4 and P6 The overall Fe2+-EDTA cleavage ⁄ protection pattern for this group IA3 intron (InDGb) has many Fig Hydroxyl radical cleavage with Fe2+-EDTA of the intron ribozyme (A) Fe2+-EDTA cleavage and protection pattern of 5¢ end-labeled InDGb RNA as a function of Mg2+ concentration The InDGb RNA, labeled at its 5¢ end through G-dependent cleavage of 23S.5DGb pre-RNA, was incubated with Mg2+ (final concentration indicated above lanes 2–12) and then cleaved with Fe2+-EDTA The reactions were resolved on gels of 5–12% polyacrylamide with ladders and other markers The locations of structural elements (P5, P6, etc.) are marked to the left of the gel image, and RNA sizes to the right Rectangular bars indicate areas where cleavage is enhanced (filled rectangles), or reduced (open rectangles), with increasing Mg2+ Other lanes are: S, starting RNA; Mn, S RNA cleaved with Mn2+ at GAAA sequences (nucleotides 56, 257 and 323); A, G, A ⁄ U, and C, enzymatic sequence ladder of S RNA; OH, partial alkaline hydrolysis of S RNA; and M, 5¢ end-labeled DNA size markers The composite figure is from 8% (upper) and 12% (lower) polyacrylamide gels (B) Phosphorimager scans of Fe2+-EDTA cleavage of InDGb RNA with and 25 mM Mg2+ The RNA was probed as in (A) and the samples resolved on a 12% polyacrylamide gel, which was phosphorimaged (C) Difference plot of Fe2+-EDTA cleavage at and 25 mM Mg2+ Regions of cleavage are positive (> 0), and regions of protection are negative (< 0) The plot was compiled from cleavage profiles obtained on a series of 5–12% polyacrylamide gels (D) Protection and cleavage patterns mapped onto the predicted secondary structure; the data are from (C) Protected nucleotides are shades of red and orange, whereas cleaved nucleotides are blue shades; a color bar is given on the bottom right The analysis under these conditions was repeated twice with similar results The accuracy of the protection data at the nucleotide level is ± for residues £ 180, ± for residues 181–270, and ± for residues 271–342 The cleavage ⁄ protection patterns of nucleotides 1–14 and 343–378 were insufficient relative to background, and are not indicated The red arrowheads indicate sites of cleavage by Mn2+-GAAA ribozymes [38] 2636 FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al similarities to the introns from other subgroups [7,8] (see also below) However, it is atypical because of the relative lack of protection of the catalytic domain and the junction nucleotides that link it to the other major domain We attempted to probe the InDGb RNA with Fe2+-EDTA in the presence of Mn2+, but cleavage was FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2637 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al too poor to obtain a clear result This is most likely due to the similar affinities of EDTA for Mn2+ and Fe2+, and the fact that Mn2+ is in large excess in these reactions [34] Discussion Kinetic analysis of Mn2+ inhibition The group I ribozyme literature indicates that divalent metals are required for tertiary folding and catalysis, and that Mg2+ or Mn2+ can satisfy these functions However, the activity of some group I introns, including three of the five introns in Chlamydomonas reinhardtii (Cr.psbA2, Cr.psbA3, and Cr.LSU) is inhibited by Mn2+ [26] We wanted to determine for the Cr.LSU intron if this metal specificity is due to a more stringent requirement for catalysis, or folding, or both The data show that Mn2+ does not have a significant effect on the kinetic parameters (K1/2G and kcat) of the 23S.5DGb ribozyme Thus, Mn2+ does not inhibit binding of the guanosine nucleotide, and nor does it suppress cleavage chemistry, suggesting that, as in the case of Tt.LSU and some other group I ribozymes, Mn2+ can support catalysis by Cr.LSU The data indicate, however, that Mn2+ inhibits formation of the active ribozyme, presumably by causing misfolding This result was unexpected, because of the extensive work with the Tt.LSU ribozyme indicating that the metal requirement for ribozyme folding is less restrictive than that for catalysis [14,15] It is also surprising that Mn2+-induced misfolding of this ribozyme is highly cooperative, with a Hill coefficient of approximately In fact, it is more cooperative than Mg2+ induction of active ribozyme (Hill coefficient of approximately 3) High cooperativity is consistent with the great stability of the RNA formed in Mn2+, which converts very slowly to a form capable of binding GMP and reacting The higher Hill coefficient could also indicate that Mn2+ binds to additional (three) sites on the ribozyme that not bind Mg2+ However, the fact that Mg2+ can completely block Mn2+ inhibition would suggest that they bind to the same sites Hence, it may be that they bind to the same basic locations, but that Mn2+ binds with slightly different configurations at some key sites, resulting in inhibition In this respect, it should be noted that, based on mixed-metal titrations of 23S.5 self-splicing, Mn2+ can functionally replace Mg2+ at some sites [26] Mn2+ inhibition of 23S.5DGb is partially alleviated by GMP, especially at lower metal concentrations The GMP concentration dependence of this effect indicates that the nucleotide is acting via the G 2638 binding site in P7 An obvious explanation for this result is that binding of GMP prevents an inhibitory Mn2+ from binding to this site Interestingly, 2¢-dGTP inhibits Pb2+ cleavage of the T4-td intron at the bulge nucleotide in P7 [30], which is very close to the bound XG in recent crystal structures [35–37] With Cr.LSU, we did not see a similar specific cleavage with Pb2+ or other metals [38], so the same experiment could not be performed It should be noted, however, that metal-dependent cleavage reveals only a small fraction of metal-binding sites in RNA [29] An alternative explanation for GMP-induced folding of the ribozyme in Mn2+ is that binding of the cosubstrate to its site induces a conformational change in the RNA that inhibits Mn2+ binding at another inhibitory site(s) It may be relevant that in vitro-evolved Tt.LSU ribozymes capable of using Ca2+ as sole divalent cation had several nucleotide substitutions clustered about the G binding site and the triple base pairs at the P4–P6 junction [39] We tried unsuccessfully to select variants of Cr.LSU active with Mn2+ from pools of mutants generated by error-prone PCR (T.-C Kuo & D L Herrin, unpublished results) Based on the high Hill coefficient reported here, however, the failure of that experiment may be attributed to the difficulty in overcoming the relatively high number of inhibitory Mn2+-binding sites in Cr.LSU We previously identified six Mn2+-binding sites in Cr.LSU based on site-specific cleavages at pH > [38] These sites all contain the sequence GAAA, and cleavage occurs between G and A The cleavage efficiency, however, varied between sites, and correlated with the predicted secondary structure Also, the addition of sufficient Mg2+ to induce self-splicing did not affect the Mn2+ cleavage rates at the various sites, suggesting that most of the intron’s secondary structure forms correctly in Mn2+ The experiments herein were performed at pH (self-splicing of Cr.LSU is efficient at pH 6–9 [23]), and for shorter times to limit the Mn2+-induced cleavages Thus, these data would suggest that Mn2+ is probably inhibiting tertiary folding of Cr.LSU In this respect, we note the published evidence [40] that correct tertiary folding of the Azoarcus intron is specific for Mg2+ However, it is possible that subtle but important changes in secondary structure could also be involved For example, the crystal structures of yeast tRNAPhe in Mg2+, or in a mixture of Mg2+ and Mn2+, are quite similar but not identical; residue D16 (D loop) forms a base pair with U59 (TWC loop) only in the latter condition [41] It is unlikely that the three remaining GAAA-Mn2+ cleavage sites in the 23S.5DGb ribozyme (three are FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al deleted) are principal targets of Mn2+ inhibition, since Mn2+ cleavage is not cooperative [38]; however, one of them could be a site of Mn2+ inhibition The best candidate would probably be J4 ⁄ 5, which is strongly cleaved with Mn2+ [38], and is involved in substrate recognition during splicing [35,36] Changing the GAAA in J4 ⁄ to GACA blocked Mn2+ cleavage and doubled the Mg2+ requirement for Cr.LSU self-splicing (T.-C Kuo, S P Holloway & D L Herrin, unpublished results), suggesting that it might be an important metal-binding site Evidence for a functional metal interaction with the J4 ⁄ 5-GAAA region of an Anabaena intron was reported recently [42] Structural and functional idiosyncrasies of the 23S.5DGb intron ribozyme To help us understand the noncanonical properties of Cr.LSU, the intron’s (InDGb) structure was analyzed using Fe2+-EDTA, which has been used extensively to view tertiary-folded group I ribozymes The chelated iron generates hydroxyl radicals that cleave riboses, unless they are protected by RNA–RNA interactions [7] Figure compares the Cr.LSU protection pattern, which is the first for a subgroup IA3 intron, with five ribozymes from other subgroups: L-21 ScaI of Tt.LSU [7], T4.nrdD [8], T4.td [8], Sc.bI5 [43], and Azoarcus Fig Comparison of the Fe2+-EDTA protection patterns of group I ribozymes Residues protected from Fe2+-EDTA cleavage are indicated by filled squares with white letters The data for Cr.LSU (A) are from Fig 5; for Tt.LSU (B) from [7]; for T4.sunY (C) and T4.td (D) from [8]; for bI5 (E) from [43]; and for Azoarcus pre-tRNAIle (F) from [44] Domain–domain interactions in introns B–F are indicated by dashed lines In (A), the lightly shaded nucleotides in the L9.1 and P7.1 loops may form a novel base-pairing interaction; the gray dashed line between L2 and P8 also indicates a possible interaction Solid arrows indicate sites of Mn2+ cleavage in Cr.LSU and T4-td; open arrows are sites of Pb2+ cleavage in Tt.LSU, T4.td, and T4.nrdD; and arrowheads in Azoarcus indicate the 5¢ and 3¢ splice sites FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2639 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al pre-tRNAIle [44] All of these introns can self-splice, although the Mg2+ requirement for bI5 is higher than that for the others Focusing on the catalytic domain (P8–P3–P7), the P3 3¢-strand is the only element that is uniformly protected in all ribozymes, although they all have parts of P7, J8 ⁄ and P9.0 protected The Cr.LSU pattern is distinct in that the first three nucleotides of P7, and the 3¢-half of J8 ⁄ 7, are not protected The first three nucleotides of P7 are part of the G binding site, as are the terminal nucleotides of J6 ⁄ and J8 ⁄ [35–37]; the latter nucleotides are also not protected in the InDGb RNA It should be noted that the three terminal nucleotides of Cr.LSU, including the XG, are not present in the InDGb RNA, which presumably also lacks P9.0 (Fig 6A) It is possible this has an effect on the protection pattern However, the kinetic parameters (kcat and K1/2G) for G-dependent cleavage by 23S.5DGb are very similar to those obtained for the first step of self-splicing by 23S.5 [18], indicating that P9.0 is not important for core ribozyme activity (it is probably important for the second step of splicing [45]) It is also noteworthy that the 3¢-terminal nucleotides were also absent from the Tt.LSU ribozyme mapped with Fe2+-EDTA [7] To conclude, the G binding site and flanking nucleotides of Cr.LSU are more accessible to solvent (i.e less internalized) than are those of other group I ribozymes studied to date It is also intriguing that the kinetic data implicate the G binding site as playing an important role in Mn2+ inhibition Why is the active site less internalized in the InDGb RNA? The lack of protection of J6 ⁄ and J3 ⁄ 4, which are involved in triple base pairs with P4 and P6 [3,35–37], and the relatively weak overall protection of the P4–P5–P6 domain (Fig 5C), indicate that this domain is not tightly packed against the catalytic domain Analysis of the predicted secondary structure suggests that Cr.LSU may be somewhat deficient in interactions between these domains For example, it seems to lack the L9 · P5 interaction found in the other ribozymes (Fig 6) This interaction is primarily between the L9 tetraloop and the second and third nucleotides of P5 [3]; however, in Cr.LSU, P5 is only two base pairs Although deletion of the P4–P5–P6 domain from the T4.td intron suggests that it is not essential [46], disruption of P6 in Cr.LSU obliterated self-splicing, and point mutations in P4 strongly decreased splicing in vitro and in vivo, indicating that the P5–P4–P6 domain is important for Cr.LSU [25] The Li et al study [25] also indicates that Cr.LSU is more sensitive to single nucleotide substitutions in the core than Tt.LSU or T4.td, which is consistent with fewer tertiary 2640 interactions Li et al [25] also isolated nuclear gene suppressors of the P4 mutations; thus, based on these data, it is reasonable to speculate that one or more of these suppressors promote interaction between the two major domains There are other functional differences between Cr.LSU and the Tt.LSU and phage T4 introns besides Mn2+ inhibition that may reflect the distinctive structures It was shown that Pb2+ promotes specific cleavages in the P7 and J8 ⁄ regions of Tt.LSU and the phage introns (Fig 6B–D) in the presence of Mg2+ [30] However, we did not observe similar specific cleavages in Cr.LSU with Pb2+ (or other cations) [38] Cr.LSU is also more resistant to inhibition by polycationic aminoglycoside antibiotics, such as neomycin B [47], requiring 25–50-fold higher concentrations to inhibit self-splicing in vitro by 50% (T.-C Kuo, Y Bao & D L Herrin, unpublished results) It is noteworthy that neomycin inhibits the T4.td intron by binding at the G binding site and displacing one or two critical Mg2+ ions [48] We propose that the lack of Pb2+ cleavage, and the apparent absence of a highaffinity, inhibitory site for neomycin, could be consequences of the more open structure of Cr.LSU, which should present a less electronegative environment at the active site It would be interesting to know if other group I introns that are inactive with Mn2+ [24] have properties similar to those of Cr.LSU, including the more stringent metal requirement for ribozyme formation The tertiary-folded structure of the InDGb RNA in Mn2+ would probably have been instructive, but unfortunately, the Fe2+-EDTA cleavage pattern was strongly inhibited by Mn2+ under these conditions, presumably due to the similar affinities of EDTA for Mn2+ and Fe2+ (Kd approximately 10)14.1) [34] It may be possible to accomplish this with synchrotron X-ray [49] or peroxynitrous [50] cleavage, although the former requires special equipment, and the latter reagent is not as easy to use as Fe2+-EDTA An intriguing, though speculative, implication of the relatively open ground-state structure of InDGb is that the ribozyme might undergo a transient internalization of P7, J8 ⁄ and J6 ⁄ after binding GMP to start the reaction Binding of the guanosine nucleotide by the Tt.LSU ribozyme is very slow, and is believed to induce a local rearrangement of the G binding site [51]; these authors also argued that an incompletely preformed G binding site could promote specificity The posited conformational rearrangement of Cr.LSU would seem to be more extensive, but if it does happen and is necessary, then that dynamic change could be a key step that is inhibited by Mn2+ FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al plotted on semilogarithmic scales against time The observed decrease in pre-RNA was fitted to the two-component first-order equation: Experimental procedures DNA templates and in vitro RNA synthesis The DNA template for in vitro synthesis of 23S.5DGb preRNA, PCR23S.5DGb, was generated by PCR using Taq polymerase and the manufacturer’s conditions (Perkin Elmer-Cetus, Norwalk, CT, USA) The template was plasmid pGEM23S.5 [18], and oligos 104 and 158 served as the 5¢ and 3¢ primers, respectively Plasmid pGEM23S.5 contains a shortened intron (380 bp), 26 bp of the 5¢ exon, and 25 bp of the 3¢ exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 1–17), a six-nucleotide transcription enhancer, an EcoRI restriction site, 14 nucleotides of authentic 5¢ exon, and the first two nucleotides of the Cr.LSU intron Oligo 158 (26 nucleotides, GAAATTTTAAAGCCGAATAAAACTTG) ends nucleotides before the 3¢-end of the intron The temperature program was 30 cycles of 94 °C, 65 °C, and 72 °C (1 each) Transcription of PCR23S.5DGb and purification of the RNA on denaturing gels was performed as described [18] G-dependent cleavage of 23S.5DGb pre-RNA, and quantication %Preịt ẳ A expka tị ỵ B expkb tị A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same parameters for the slow fraction; t is reaction time (min) These parameters were determined at different GMP concentrations (1–300 lm) The catalytic constant (kcat) and half-maximal GMP concentration (K1/2G) were obtained by fitting ka and [GMP] to: G ka ¼ kcat ẵGMP=K1=2 ỵ ẵGMPị 3ị K1/2G is not a true Michaelis–Menten constant, because the ribozyme does not perform turnover catalysis Estimating the minimum number of required metal ions: Hill analysis Rationale From Scheme 1, the fraction of active pre-RNA, f(preRNA)active, is related to Mg2+ and Mn2+ by: ẵf pre-RNAịactive ẳ ẵpre-RNA nMg2ỵ active =ẵpre-RNAtotal ẳ ẵMg2ỵ n =fẵMg2ỵ n m Prior to the reaction, the RNA was denatured by heating (90 °C, min) and cooled slowly (1 C° ⁄ s) to 37 °C in the absence of divalent metals The RNA (2–8 nm, 1500– 8000 c.p.m.) was preincubated with MgCl2 and ⁄ or MnCl2 in 50 mm Mes-KOH pH 6.0 (the relatively low pH reduces Mn2+-promoted cleavage at GAAA) at 37 °C for 20 min, and then G-dependent cleavage was initiated by raising the temperature to 47 °C and adding GMP (2–300 lm) The reactions were performed in siliconized tubes in either or 50 lL (time course) The reactions were stopped with 1.2 volumes of 80% formamide, 0.1% bromophenol blue, 0.1% xylene cyanol, 100 mm EDTA, pH 8.0, and the RNA was denatured by heating at 65 °C for before electrophoresis on 4% polyacrylamide ⁄ m urea gels The dried gels were imaged with a phosphorimager, and quantified using ImageQuant (Molecular Dynamics, Sunnyvale, CA, USA) [18] 2ị ỵ KMg 2ỵ ỵ ẵMn2ỵ =KMn 2ỵ ịg 4ị The [pre-RNAnMg2+]active term is the concentration of active ribozyme, and [pre-RNA]total is the RNA concentration KMg2+ and KMn2+ are the apparent dissociation constants for the RNA–nMg2+ and RNA–mMn2+ complexes To determine n, f(pre-RNA)active at varying Mg2+ concentration was tted to: n n f pre-RNAịactive ẳ ẵMg2ỵ =ẵMg2ỵ ỵ C1 ị 5ị where m C1 ẳ KMg 2ỵ ỵ ẵMn2ỵ =KMn 2ỵ Þ To determine m, f(pre-RNA)active was fitted to m f pre-RNAịactive ẳ C2 =C3 ỵ ẵMn2ỵ ị 6ị where n 2ỵ 2ỵ 2ỵ C2 ẳ ẵMg2ỵ KMn =KMg ; and C3 ẳ C2 ỵ KMn Estimation of the catalytic constant, kcat, and K1/2G for G-dependent cleavage For the 23S.5DGb pre-RNA, the percentage remaining at time t (% Pre) is given by: %Preị ẳ Pre=ẵPre ỵ InDGb þ 26=377ފ  100% ð1Þ Pre and InDGb are the amounts in c.p.m of the pre-RNA and intron, respectively, and 26 ⁄ 377 accounts for the liberated 5¢ exon, which was not measured The percentages were In principle, the absolute value of f(pre-RNA)active can only be obtained from the value of A (Eqn 2) in a timedependent reaction However, for determining n and m, relative values from single initial-time measurements are sufficient At the initial time points, the vast majority of product comes from the highly active fraction Hence, plots of the percentage of total RNA that is InDGb yield n and m from Eqns and FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2641 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al Procedure Acknowledgements G-dependent cleavage of internally labeled 23S.5DGb preRNA (2000–3000 c.p.m.) was performed for 40 s at the indicated concentrations of Mg2+ and Mn2+, 150 lm (saturating) GMP, 50 mm Mes-KOH pH 6.0 at 47 °C The reactions were separated on denaturing gels, and quantified as described above The amount (c.p.m.) of InDGb formed at i mm Mg2+ and j mm Mn2+ was first expressed as %InDGb using the following definition: OWO and DLH were supported by a grant from the Department of Energy (DE-FG03-02ER15352) and the Robert A Welch Foundation (F-1164) TCK was supported by a grant from the Taiwan National Science Council (NSC 94-2218E038) and Taipei Medical University (TMU94AE1B05) %InDGbi;j ¼ 100%  InDGb =ẵpre-RNA ỵ InDGb ỵ 26=377ị 7ị InDGb and pre-RNA are in c.p.m., and the 26 ⁄ 377 accounts for the 5¢ exon This normalizes the slight differences (± 10%) in RNA loaded per lane Relative InDGb percentage at i mm Mg2+ and j mm Mn2+ was defined as: Relative InDGb % ẳ ẵ%InDGbi;j ị=%InDGb max ị 100% 8ị %InDGb max is the maximum %InDGb obtained at varying Mg2+ and fixed Mn2+ concentrations, or vice versa The value of Relative InDGb% replaced f(pre-RNA)active in Eqns and 6, and the values of n and m were obtained by curve fitting with KaleidaGraph (Synergy) Probing the structure of the 23S.5DGb ribozyme with Fe2+-EDTA The InDGb RNA was 5¢-labeled by G-dependent cleavage of nonradioactive 23S.5DGb pre-RNA (3 pmol) with 20 lm [a-32P]GTP (3000 CiỈmmol)1), 25 mm Mg2+ for at 47 °C The RNA was purified, renatured as described above, and then preincubated at 47 °C for 15 in 0–250 mm MgCl2, 15 mm Tris ⁄ HCl, pH 7.5 Cleavage was effected by adjusting the mixture to mm Fe(NH4)2(SO4)2, mm EDTA, mm dithiothreitol [7] and incubating at 42 °C for 50 The reactions were terminated with thiourea (10 mm) and gel-loading solution For gel markers, end-labeled InDGb RNA (2–4 · 105 c.p.m.) was digested with RNases U2, T1, Phy M, or CL3, cleaved with alkali, and cleaved with Mn2+ (3 mm MnCl2, 0.2 m KCl, 50 mm Tris ⁄ HCl, pH 7.4, at 47 °C for 15 min) DNA size markers were prepared by restricting a 5¢ end-labeled EcoRI ⁄ HindIII insert (443 bp) of plasmid pGEM23S.5 [18] with HphI, BstXI, and XhoI Samples were denatured and separated on a series of denaturing polyacrylamide (5–12%) gels, powered at approximately 50 W (50–55 °C); the gels were imaged and quantified as above The data were corrected for background hydrolysis, and normalized to adjust for loading differences (by integrating the signal along the entire length of the lanes) [14] Using the sequence ladders as a guide, positions in the lanes could be related to corresponding nucleotides in the sequence 2642 References Vicens Q & Cech TR (2005) Atomic level architecture of group I introns revealed Trends Biochem Sci 31, 41–51 Woodson SA (2005) Structure and assembly of group I introns Curr Opin Struct Biol 15, 324–330 Michel F & Westhof E (1990) Modeling of the threedimensional architecture of group I catalytic introns based on comparative sequence analysis J Mol Biol 216, 585–610 Suh SO, Jones KG & Blackwell M (1999) A group I intron in the nuclear small subunit rRNA gene of Cryptendoxyla hypophloia, an ascomycetous fungus: evidence for a new major class of group I introns J Mol Evol 48, 493–500 Doudna JA & Cech TR (1995) Self-assembly of a group I intron active site from its component tertiary structural domains RNA 1, 36–45 Cech TR & Golden BL (1999) Building a catalytic active site using only RNA In The RNA World, 2nd edn (Gesteland R, Cech TR & Atkins J, eds), pp 321– 350 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York Latham JA & Cech TR (1989) Defining the inside and outside of a catalytic RNA molecule Science 245, 276– 282 Heuer TS, Chandry PS, Belfort M, Celander DW & Cech TR (1991) Folding of group I introns from bacteriophage T4 involves internalization of the catalytic core Proc Natl Acad Sci USA 88, 11105–11109 Cech TR & Herschlag D (1996) Group I ribozymes: substrate recognition, catalytic strategies, and comparative mechanistic analysis In Catalytic RNA (Eckstein F & Lilley DM, eds), pp 1–17 Springer, Heidelberg 10 Thompson AJ & Herrin D (1994) A chloroplast group I intron undergoes the first step of reverse splicing into host cytoplasmic 5.8S rRNA Implications for intron-mediated RNA recombination, intron transposition and 5.8S rRNA structure J Mol Biol 236, 455–468 11 Pyle AM (1993) Ribozymes: a distinct class of metalloenzymes Science 261, 709–714 12 Woodson SA (2005) Metal ions and RNA folding: a highly charged topic with a dynamic future Curr Opin Chem Biol 9, 104–109 FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al 13 Grosshans CA & Cech TR (1989) Metal ion requirements for sequence-specific endoribonuclease activity of the Tetrahymena ribozyme Biochemistry 28, 6888– 6894 14 Celander DW & Cech TR (1991) Visualizing the higher order folding of a catalytic RNA molecule Science 251, 401–407 15 Takamoto K, He Q, Morris S, Chance MR & Brenowitz M (2002) Monovalent cations mediate formation of native tertiary structure of the Tetrahymena thermophila ribozyme Nature Struct Biol 9, 928–933 16 Pan J & Woodson SA (1998) Folding intermediates of a self-splicing RNA: mispairing of the catalytic core J Mol Biol 280, 597–609 17 Treiber DK, Rook MS, Zarrinkar PP & Williamson JR (1998) Kinetic intermediates trapped by native interactions in RNA folding Science 279, 1943–1946 18 Kuo TC & Herrin DL (2000) A kinetically efficient form of the Chlamydomonas self-splicing ribosomal RNA precursor Biochem Biophys Res Commun 273, 967–971 19 Treiber DK & Willamson JR (2001) Beyond kinetic traps in RNA folding Curr Opin Struct Biol 11, 309–314 20 Gampel A, Nishikimi M & Tzagoloff A (1989) CBP2 protein promotes in vitro excision of a yeast mitochondrial group I intron Mol Cell Biol 9, 5424– 5433 21 Guo Q & Lambowitz AM (1992) A tyrosyl-tRNA synthetase binds specifically to the group I intron catalytic core Genes Dev 6, 1357–1372 22 Herrin DL, Chen YF & Schmidt GW (1990) RNA splicing in Chlamydomonas chloroplasts Self-splicing of 23S preRNA J Biol Chem 265, 21134–21140 23 Thompson AJ & Herrin DL (1991) In vitro self-splicing reactions of the chloroplast group I intron Cr.LSU from Chlamydomonas reinhardtii and in vivo manipulation via gene-replacement Nucleic Acids Res 19, 6611–6618 24 Holloway SP & Herrin DL (1998) Processing of a composite large subunit rRNA: studies with Chlamydomonas mutants deficient in maturation of the 23S-like rRNA Plant Cell 10, 1193–1206 25 Li F, Holloway SP, Lee J & Herrin DL (2002) Nuclear genes that promote splicing of group I introns in the chloroplast 23S rRNA and psbA genes in Chlamydomonas reinhardtii Plant J 32, 467–480 26 Kuo TC (1998) The group I ribozyme from the chloroplast rRNA gene of Chlamydomonas reinhardtii: kinetic and structural analysis of the divalent metal requirement and specific interactions with Manganese (II) PhD Dissertation, University of Texas 27 Kazakov S (1996) Nucleic acid binding and catalysis by metal ions In Bioorganic Chemistry: Nucleic Acids (Hecht SM, ed.), pp 244–287 Oxford University Press, New York 28 Feig AL (2000) The use of manganese as a probe for elucidating the role of magnesium ions in ribozymes Met Ions Biol Syst 37, 157–182 29 Pan T, Long DM & Uhlenbeck OC (1993) Divalent metal ions in RNA folding and catalysis In The RNA World (Gesteland R, Cech TR & Atkins J, eds), pp 271–302 Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York 30 Streicher B, von Ahsen U & Schroeder R (1993) Lead cleavage sites in the core structure of group I intronRNA Nucleic Acids Res 21, 311–317 31 Tullius TD & Greenbaum JA (2005) Mapping nucleic acid structure by hydroxyl radical cleavage Curr Opin Chem Biol 9, 127–134 32 Thompson AJ, Yuan X, Kudlicki W & Herrin DL (1992) Cleavage and recognition pattern of a doublestrand-specific endonuclease (I-CreI) encoded by the chloroplast 23S rRNA intron of Chlamydomonas reinhardtii Gene 119, 247–251 33 Laggerbauer B, Murphy FL & Cech TR (1994) Two major tertiary folding transitions of the Tetrahymena catalytic RNA EMBO J 13, 2669–2676 34 Perrin DD & Dempsey B (1974) Buffers for Ph and Metal Ion Control Chapman & Hall, London 35 Golden BL, Kim H & Chase E (2005) Crystal structure of a phage Twort group I ribozyme–product complex Nat Struct Mol Biol 12, 82–89 36 Adams PL, Stahley MR, Gill ML, Kosek AB, Wang J & Strobel SA (2004) Crystal structure of a group I intron splicing intermediate RNA 10, 1867–1887 37 Guo F, Gooding AR & Cech TR (2004) Structure of the Tetrahymena ribozyme: base triple sandwich and metal ion at the active site Mol Cell 16, 351–362 38 Kuo TC & Herrin DL (2000) Quantitative studies of Mn2+-promoted specific and non-specific cleavages of a large RNA: Mn2+-GAAA ribozymes and the evolution of small ribozymes Nucleic Acids Res 28, 4197– 4206 39 Lehman N & Joyce GF (1993) Evolution in vitro of an RNA enzyme with altered metal dependence Nature 361, 182–185 40 Rangan P & Woodson SA (2003) Structural requirement for Mg2+ binding in the group I intron core J Mol Biol 329, 229–238 41 Shi H & Moore PB (2000) The crystal structure of yeast ˚ phenylalanine tRNA at 1.93 A resolution: a classic structure revisited RNA 6, 1091–1105 42 Luptak A & Doudna JA (2004) Distinct sites of phosphorothioate substitution interfere with folding and splicing of the Anabaena group I intron Nucleic Acids Res 32, 2272–2280 43 Weeks KM & Cech TR (1995) Protein facilitation of group I intron splicing by assembly of the catalytic core and the 5¢ splice-site domain Cell 82, 221–230 FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS 2643 Mn2+ inhibition and structure of Cr.LSU ribozyme T.-C Kuo et al 44 Rangan P, Masquida B, Westhof E & Woodson SA (2003) Assembly of core helices and rapid tertiary folding of a small bacterial group I ribozyme Proc Natl Acad Sci USA 100, 1574–1579 45 Michel F, Netter P, Xu M-Q & Shub DA (1990) Mechanism of 3¢ splice-site selection by the catalytic core of the sunY intron of bacteriophage T4: the role of a novel base-pairing interaction in group I introns Genes Dev 4, 777–788 46 Ikawa Y, Shiraishi H & Inoue T (2000) Minimal catalytic domain of a group I self-splicing intron RNA Nature Struct Biol 7, 1032–1035 47 Schroeder R, Waldisch C & Wank H (2000) Modulation of RNA function by aminoglycoside antibiotics EMBO J 19, 1–9 48 Walter F, Vicens Q & Westhof E (1999) Aminoglycoside–RNA interactions Curr Opin Chem Biol 3, 694–704 2644 49 Sclavi B, Woodson S, Sullivan M, Chance MR & Brenowitz M (1997) Time-resolved synchrotron X-ray footprinting, a new approach to the study of nucleic acid structure and function: application to protein– DNA interactions and RNA folding J Mol Biol 266, 144–159 50 Chaulk SG & MacMillan A (2000) Characterization of the Tetrahymena ribozyme folding pathway using the kinetic footprinting reagent peroxynitrous acid Biochemistry 39, 2–8 51 Karbstein K & Herschlag D (2003) Extraordinarily slow binding of guanosine to the Tetrahymena group I ribozyme: implications for RNA preorganization and function Proc Natl Acad Sci USA 100, 2300–2305 FEBS Journal 273 (2006) 2631–2644 ª 2006 The Authors Journal compilation ª 2006 FEBS ... and the binding of a minimum of n Mg2+ ions leads to formation of the active complex, whereas binding of a minimum of m Mn2+ ions forms the inactive complex The sizes of the active and inactive... that the kinetic data implicate the G binding site as playing an important role in Mn2+ inhibition Why is the active site less internalized in the InDGb RNA? The lack of protection of J6 ⁄ and. .. Mn2+-induced misfolding of this ribozyme is highly cooperative, with a Hill coefficient of approximately In fact, it is more cooperative than Mg2+ induction of active ribozyme (Hill coefficient of approximately