Development of a DTPA soil test for zinc, iron, manganese, and cropper
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... Teltow/Berlin, Germany;2Institute for Molecular Biosciences, The University of Queensland, St Lucia,Australia A novel photoactivatable analog of antisauvagine-30 (aSvg-30), a specific antagonist for corticotropin-releasing ... elucidate the role of the aromatic and heteroaromatic N-terminal rings of antisauvagine-30 twotyrosine-11 substituted analogs and a deleted version of aSvg-30 were synthesized and tested for selective ... heated(100 °C, 5 min) and subjected to SDS/PAGE. Autoradio-graphy was carried out on a BAS-IP NP 2040P imagingplate. Radioactivity was monitored with a Fujix BAS 2000scanner (Raytest, Straubenhardt)....
- 7
- 344
- 0
Development of the Quantitative PCR Method for Candidatus ‘Accumulibacter phosphatis’ and Its Application to Activated Sludge
... Candidatus ‘Accumulibacter phosphatis’ GTTAGCTACGGCACTAAAAGG This studyPAO462 Candidatus ‘Accumulibacter phosphatis’ CCGTCATCTACWCAGGGTATTAAC Crocetti et al . (2000)PAO651 Candidatus ‘Accumulibacter ... phosphatis’ CCCTCTGCCAAACTCCAG Crocetti et al. (2000)PAO846 Candidatus ‘Accumulibacter phosphatis’ GTTAGCTACGGCACTAAAAGG Crocetti et al. (2000)EUB338 Most eubacteria GCTGCCTCCCGTAGGAGT Amann et al ... AGAGTTTGATCCTGGCTCAG Lane (1991)1492r Most eubacteria, archaebacteria GGCTACCTTGTTACGACTT Lane (1991)PAO651f Candidatus ‘Accumulibacter phosphatis’ CTGGAGTTTGGCAGAGGG This studyPAO846r Candidatus...
- 7
- 719
- 0
Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests
... Marine PestsPriorities and hazards for Economies Variable levels of activity and management capabilityShips’ ballast water and hull fouling are the most important vectorsInternational ... strategic measuresManagement Framework - Introduced Marine PestsPhase 1 – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC EconomiesConsiderations ... vectorsInternational shipping, aquaculture and biodiversity are most threatened values Amount of commercial shipping and number of trading partners affecting pathway strength A limited number of...
- 10
- 583
- 0
Tài liệu DEVELOPMENT OF AN AUTOUMATIC DATA PROCESSING FOR TRIAXIAL COMPRESSION TEST pdf
... direction of the camera and boundary are parallel. The oil color and the light are stable. Some features of camera: The maximum dimensions of camera window are 143x80 pixels. Set color parameters ... such as: automatic record testing result during test; attain the required accuracy; easy manufacture with acceptable costs. There are some commercial automatic testing machines available in ... processing and the examiner can not look at watch and equipments displaying parameter at the same time. (2) Inconveniences in recording parameters and calculating results The triaxial test sometimes...
- 9
- 613
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... 5¢-CTCGAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCAGGGG-3¢ for the latter. The ... FEBS Development of a new method for isolation and long-termculture of organ-specific blood vascular and lymphaticendothelial cells of the mouseTakashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko ... CalmanoviciRW, Martin-Padura I, Breviario F, Garlanda C,Ramponi S, Mantovani A & Vecchi A (1997) A generalstrategy for isolation of endothelial cells from murinetissues. Characterization of two...
- 11
- 873
- 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAA AATGGAGC AGAAA CTCATCTCTGAAGAGGATCTG -3¢) and (5¢- GCATGC CTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢), and checked for the presence and sequence of thenew ... (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCAGAAACTCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGTGACCGCCTCCC-3¢); for Golf(5¢-GGTACCGCTGCAATGGGGTGTTTGGGCAAC-3¢) ... was performed on DNAse-treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCTAAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AGCTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAATTTTGCTGCC-3¢);...
- 14
- 473
- 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... data and the output meshes. The software package has been initially used as a tool for 3D structured mesh generation for simulations of compressible turbulent atmospheric flows and air quality ... viewing and presenting the topographic data and the generated meshes. The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics ... equation (1) is just an one to one inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6]. For short, the formulae for Y and...
- 14
- 402
- 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot
... (deamidation). TGases comprise a family of eight isozymes (Factor XIII and TGases 1–7) thatare distributed in a variety of tissues and have uniquesubstrate specificities. Factor XIII and TGase ... – 2A – 1A QN+ 1A + 2A + 3A + 4A + 5A + 6A + 7A + 8A + 9A Relative value00.20.40.60.811.21.4Fig. 4. Assessment of the contribution of each amino acid residue of K5 to substrate recognition. Alanine ... ,647–655.40 Hiiragi T, Sasaki H, Nagafuchi A, Sabe H, Shen SC,Matsuki M, Yamanishi K & Tsukita S (1999) Transglu-taminase type 1 and its cross-linking activity are con-centrated at adherens junctions...
- 11
- 449
- 1
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... This research is also a case study of ana- lyzing and improving manual tagging that is applicable to any tagging task. We perform a statistical analysis that provides information that complements ... Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat tDepartment of Computer Science and ... ing manual results in as much as a 16 point im- provement in pairwise Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can...
- 8
- 354
- 0
Từ khóa: development of a rapid screening procedure for growth and lipid content of microalgaedevelopment of a genetic transformation system for microalgaethe development of a stem cell therapy for deafnessdevelopment of a regional risk management framework for apec economies for use in the control and prevention of introduced marine pestsdevelopment of a terrestrial index of ecological integrity tiei a new tool for ecosystem managementdevelopment of a simple model for vaccination against haemonchusdevelopment of a stress insensitive mgcuzn nicuzn composite ferrite useful for microinductors apdevelopment of a framework for developmental immunotoxicity dit testingdevelopment of a multi functional 22 channel functional electrical stimulator for paraplegiadevelopment of a scoring system to screen for brca1 2 mutationsdevelopment of a knowledge based system based on collaborative filtering recommendation for training knowledge sharingdevelopment of the arizona cognitive test battery for down syndromedevelopment of a dosing formula for carboplatindevelopment of a cation exchange purification step for an fc fusion proteinbailey j pearson s 1983 development of a tool for measuring and analyzing computer user satisfaction management science 29 5 530 545Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ