... AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5 -AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5 -CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5 -GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT ... yeast strain induced at 15 °C, and from yeast expressing SSTR2 as a control activity By taking advantage of structural and functional similarities between yeast and mammalian GPCR signaling pathways, ... to a signaling pathway that produces a measurable response to odorant stimulation The yeast system was chosen for several reasons Firstly, S cerevisiae has been successfully used for functional...
... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... Iversen of AVI BioPharma for providing MARV-specific PMOs, and Drs A. L Schmaljohn, D.L Swenson, M .J Aman and K.E Steele for suggestions and helpful discussions A portion of the research described ... wild-type virus and was 7. 75 (± 0.46) days after 15 passages The MTD for MARV-Ravn began at 39.4 (± 5. 48) days and was 10.3 (± 0.71) days after 10 passages in scid mice The viral titers in the liver...
... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of ... Iversen of AVI BioPharma for providing MARV-specific PMOs, and Drs A. L Schmaljohn, D.L Swenson, M .J Aman and K.E Steele for suggestions and helpful discussions A portion of the research described ... wild-type virus and was 7. 75 (± 0.46) days after 15 passages The MTD for MARV-Ravn began at 39.4 (± 5. 48) days and was 10.3 (± 0.71) days after 10 passages in scid mice The viral titers in the liver...
... challenge To place a sensor node and its antenna at the same place and orientation in a deeper hole is not an easy task This issue is aggravated with the use of small holes, such as a 10 cm-diameter ... sensors are some examples of soil sensors that can be used to gather water potential measurements This method provides a more realistic measurement of the actual plant water stress and, therefore, ... results of WUSN experiments These results are presented as examples of the successful use of the WUSN testbed and its related guidelines For more detailed analysis of the results, the reader is...
... Williams A: Footwear assessment andmanagement Podiatry Now 2006 :S1 -S9 Nancarrow S: Footwear suitability scale: A measure of shoefit for people with diabetes Australas J Podiatr Med 1999, 33 :57 -62 ... 95% LOAs for quantitative measures are shown in Table Similar intra-rater reliability was found for both raters across all measures Most quantitative measures demonstrated excellent or almost ... previous results Statistical analysis Since only three shoes contained multiple density midsoles, lateral and medial midsole hardness items were combined for data analysis Intra-rater and inter-rater...
... transfected these 12 groups of plasmid DNA into 293 T cells and again subjected them to FACS analysis and gating as before The EGFP-C1 vector was used as a control Because enhanced green fluorescent ... degradation Additional data file contains the original data used to perform this analysis and is available with the online version of this paper interactions Additional data files refereed research ... pertussis toxin-insensitive G proteins such as the Ga12 class, it causes the activation of several cytoplasmic protein tyrosine kinases: Src, Pyk2 (proline-rich tyrosine kinase 2) and Fak (focal adhesion...
... levels for star anise are classified as follows Assessement results demonstrate that Lang Son has great potential to expand area of growing star anise Compared to other agricultural crops and forest ... the assessment -24results and classification of bioclimatic adaptation on the basis of the assessement findings of bioclimatic adaptation CONCLUSIONS AND RECOMMENDATIONS A CONCLUSIONS Compared ... differentiatial characteristics of bioclimate-soil resouces on territory studied, the evaluation criteria is selected for black cardamom and its adaptative levels was classified and assessed Comparison...
... (3-(4 ,5- dimethylthiazol-2-yl)-2 ,5- diphenyltetrazolium bromide) assay, the MTS tetrazolium assay, the AlamarBlue® assay and the Promega series of screening assays, including Caspase and assays [26 29] The AlamarBlue® ... biochemical-based assays, and to apply cell-based assays for drug discovery [34] Cell-based assays characterize a range of variables such as cell proliferation, toxicity, motility, generation ofa measurable ... cater to a myriad of important applications There is an increasing demand for the accurate processing of scarce samples, such as stem cells, cancer stem cells and patients’ samples Miniaturization...
... display similar mechanical behaviour (shape of the stress–strain and stress relaxation response), have mechanical properties that are similar to or greater than the tissue it is regenerating; and ... Figure 5. 3 Mechanical parameters of cell-seeded scaffolds measured using Instron for static and non-static cultures Figure 5. 4 55 57 -58 Comparison of bMSCs proliferation on silk scaffolds under ... investigations, such as better understanding of tissue developmentand the mechanisms of disease, off-the-shelf provision of essential transplantable tissue and scale-up for commercial production of engineered...
... hour After that, all bioreactors parts are assembled inside a biological safety cabinet The basic straining mechanism of bioreactors for tubular form scaffolds and sheet form scaffolds are the same ... provision of essential transplantable tissue, and possible scale-up for commercial production of engineered tissues Mechanical stress plays a significant role in tissue formation and repair in ... results and are referred to as the “gold standard” [Fu et al, 1999] The autografts have many advantages, such as avoidance of immunological and infectious problems of grafts rejection or disease...
... exercises will ensure appropriate selection EXPLAIN ALL SAFETY-RELEVANT AS WELL AS OTHER MAJOR CHARACTERISTICS OF ECDIS DATA SUCH AS DATA CONTENTS, HANDLE ECDIS DATA ON BOARD AND ASSESS ALL ERRORS, ... 1 .A. e 1.C .a Assess the impairment of ECDIS performance in the case of deterioration in sensor performance 5. 2 FALL-BACK SENSOR SYSTEMS Select and use an appropriate fall-back sensor system by switching ... address these topics 3.4 DATA QUALITY: Explain why chart data quality is dependent on factors such as (survey-)accuracy, updatedness, coverage and completeness of chart data Assess that the data...
... test for multiple comparisons of means The data are expressed as Mean ± SD and statistical analysed was performed using Graphpad Prism version 4.0 and Microsoft Office EXCEL Specific growth rated ... case of length Results and discussions The result clearly indicated that the clay-sandy substrata produced higher survival rate and total biomass compared to sandy or clay substrate (P
... (soft substrate) grew faster than in sandy and scallop shell substrata (hard substrate) and less in no substrate tanks Soft substrate (clay substrate) would be more appropriated for larvae at settlement ... for larvae settlement with highest rate of survival Sandy substrate and scallop shell substrate are also considered because it is normal substrata that easy to take it into hatchery 5. 3 Propagation ... rapidly in clay, sandy and scallop shell substrata, and slowly in tanks with no substrate on bottom (Table 7) At the end of period (day 12 and day 15) , larvae reared in clay substrate (soft substrate)...
... survival rate of the larvae For this species, survival rate is generally percentages from D larval stage to juvenile stage • When larvae reach the settling stage and metamorphosis stages, they are ... 7- 35 ppt • Substrata: clay-sandy (20% clay, 80% sand) • Substrata of nursery place should clay-sandy (70-80% sand and 20-30% clay) 31 • Salinity at 19-26‰ Site preparation • To plough and turn ... Final assessment • Data processing • ACTIVITIES 3.1.1 Preparation of culture area Report Project impact assessment Pre and post implementation phases • Preparation of structured questionnaire...
... are the main activities: • Training • In country training Training for lead farmers Training for ARSINC staff Workshops and study tours for staff and farmers • Overseas training (Australia) Structured ... overseas (Australia) The overseas training program mainly targeted to ARSINC and provincial staff who are actively engaged in the project activities Overseas training consists of structure training ... (Future Skill Base) University Students ARSINC Staff Extension Staff Extension Staff In-country ARSINC/SARDI Staff ARSIC Staff Lead Farmers Extension Staff ARSIC Staff Flow chart: Indicating competency...
... the facility of ARSINC’ hatchery had upgraded for stable production at least marine algal species: Nanochloropsis, Isochrysis, Tetraselmis and Chaetoceros, which was the major factor, assisted ... kumar.martin@saugov sa.gov.au Integrated Biosystems Integrated Resource Managementand Biotechnology Organisation South Australian Research andDevelopment Institution (SARDI) In Australia: Administrative ... provinces (3) Publish the results of the on farm trials in aquaculture magazines and journals as a case study of evidence-based and participatory research in aquaculture (4) There is great potential...
... capabilities of smallholder end-users to monitor and manipulate By focusing upon the research and understanding of the impact of such factors on survival and growth of M lyrata and its larvae, the teams ... Recirculation System (Constant Temperature) at ARSINC A triplicate system for two treatments – Sand bottom and Solid bottom was set up at ARSINC This comprised ofa total of six 400L tanks in a recirculation ... treatment, there are ponds for triplicates of substrata such as sand bottom, clay-sand bottom and clay bottom and Density treatment, there are ponds for triplicates of density levels (90clams/m...
... site databases There are a number of databases that are significantly larger than the NFI-Regulome Database as assessed by the number of binding sites annotated including TRANSFAC [16], JASPAR ... and perl scripts to annotate and populate the database and worked on database and table design and interaction SMG contributed to manuscript preparation and future database design All authors ... Lenhard B, Wasserman WW, Sandelin A: JASPAR 2010: the greatly expanded open-access database of transcription factor binding profiles Nucleic Acids Res 2010, 38(Database issue):D1 05- 10 18 Gronostajski...
... conditions CONCLUSION optical shift The optical measuringof the diameter at various heights of stem using the wedge prism as atoolfor measurement is a sufficiently accurate method for measurement and ... can measure the distance as well, for instance by laser, the method of sorting is sufficiently precise and cheap In addition, the method can be used for the measuringof distances in forests (from ... is essential for calculating the volume in forests (virgin forests) where the yield tables not exist or for the revision of the existing tables The stem is divided into parts and they are calculated...