... Management Framework - Introd
uced Marine Pests
Priorities and hazards for
Economies
Variable levels of activity and
management capability
Ships’ ballast water and hull
fouling are ... results
of the November 2001 Workshop
Management Framework - Introd
uced Marine Pests
Management capabilities
and approaches
APEC and the MRCWG have a role in liaising
with IMO, FAO, NACA to ... Introd
uced Marine Pests
Phase 1 – Consultancy
Identified current management
capabilities and approaches
Priorities and hazards for APEC
Economies
Considerations for a Risk
Management Framework
Conclusions,...
... spectroscopy
has a very important role in studies of optical properties of materials. Our goal
is to build a spectrometry system to measure weak optical signals such as
Raman scattering and surface SH ... He-Ne laser instead of Ion Argon laser. The Raman
excitation by He-Ne laser showed many advantages in comparison with Argon laser
excitation.
Acknowledgements: This work is supported by the Natural ... Key board, display board, Analog Input board,
DSP Logic board and CPU and Power supply board. The DSP logic board takes a
digital input from the A/ D converter on the Analog Input board and perform...
... in nature to a data manager which fails to free
data, but is easier to detect and prevent.
• Data manager changes data. A malicious data manager may change the value of its data on each cache
refresh. ... performed on a task.
3.4. External Memory Management
An important part of the Mach strategy was a reworking of the basic concept of secondary storage. Instead of
basing secondary storage around a kernel-supplied ... user
programs through a message interface. This feature allows applications such as transaction management systems to
participate in decisions regarding secondary storage management and page replacement.
This...
... chocolate, vanilla ice cream, fried chicken and mashed
potatoes and gravy. Pizza and chocolate produced the strongest
emotions based on Analysis of Variance. The terms active, adven-
turous, affectionate, ... differentiating flavor variations of the same product. Data
from this ballot were evaluated using Analysis of Variance (GLM
procedure) in all future tests.
Table 1
Consumer classification of emotions. ... techniques which are
appropriate for the academic laboratory research might not be
appropriate for commercial settings of consumer laboratories. Aca-
demic laboratory research typically uses student...
... content management application maintains all aspects of content
components, and the metacontent management application maintains the same for
metacontent. The content delivery application generates ... have, but you will find that some CMSs don't
have a standard interface. The reason is that a lot of software that is a CMS, or that
contains CMS functionality, came from different packages ...
maintain, track, and find. It also provides a more secure way of storing your data. Having
your data localized means you have a smaller area to protect from intruders. The more
your data is...
... It
also represents an organizational infrastructure
that affects how people work and imposes its
own logic on a company’s strategy, organization
and culture. After organizations accept the
management ... of technology pre-
paration and organizational change management. Although the importance of knowledge
management (KM) in ERP implementation has been recognized, how to conduct
knowledge management ... Industrial Man-
agement and Data Systems 100(5–6): 261–270.
Li L. 2000b. An analysis of the sources of competitive-
ness and performance of Chinese manufacturers.
International Journal of Operations...
... &
Case Study
A Case Study on the Implementation of
A Knowledge Management Strategy
Oriented to Innovation
Francisco J. Forcadell
1
* and Fa
´
tima Guadamillas
2
1
Universidad Rey Juan Carlos, ... via overall external evaluations
and detailed self-evaluation. The efforts made
at the company over this period have been
recognized by the receipt ofa number of
national and international awards.
(4) ... Carlos, Madrid, Spain
2
Universidad de Castilla La Mancha, Spain
A critical aspect of business management is the successful creation of processes which drive the
development ofa continuous flow of...
... 5¢-CTC
GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA-
1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former,
and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢
and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA
GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic
endothelial cells of the mouse
Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura,
Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel
endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA,
paraformaldehyde;...
... of 2 groups and 5 travel time parameters, and a bus geodatabase
with 5 feature classes. The data management tool is designed as COM servers to
extend standard functionality of ArcGIS software. ... bus geodatabase with 5 feature
classes. For managing the geodatabase, a set of tools extending the capabilities of ArcGIS
software via COM (Component Object Model) interface has been created. ...
FROM LayerName
WHERE [Name] = "FeatName"
where LayerName is the name of layer containing searched features, FeatName is the
name of these features. If the features are found, StSearch...
... (5¢-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG
AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC
TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG
CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT
GACCGCCTCCC-3¢); ... was performed on DNAse-
treated RNA extracts. Primers used for RT-PCR were: for
the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT
AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG
CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA
TTTTGCTGCC-3¢); ... expression
vector was obtained from pJH2-SSTR2 by homologous
recombination introducing the c-myc-OR17-40 coding
sequence, using primers (5¢-CGTCAAGGAGAAAAAAC
CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC
TGAAGAGGATCTG...
... interface of the package
The package is designed with a main interface that allows users to input topographical elevation
data of the top (upper) surface of any 3D objects in the form of digitized ... viewing and presenting the topographic data and the
generated meshes. The package has been applied to the generation of 3D computational meshes
used as the input ofa computational fluid dynamics ... Nguyen Van Thang, Nguyen Tat Thang, Developmentofa software for the
simulation of atmospheric flows over complex topography, Proceedings of the 2005 Annual National Conference
on Fluid Mechanics,...
... ABA had a higher OH
•
level after ParA1 treatment. H
2
O, H
2
O
pretreatment; H + ParA1, ParA1 infiltration after H
2
O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... oligonucleotide prim-
ers: 5¢-TGAATTC
AATAATGTCTAACTTCCGCGCTCT-
GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT
GATGATGCAGTGACGCGCACGTAGA-3¢. For the suc-
cessful protein expression, a yeast expression consensus
sequence ... glutathione from Roche
(Basel, Switzerland). Catalase, SOD, ascorbic acid and
ABA were purchased from Sigma (St Louis, MO, USA).
All other mentioned reagents were of analytical grade.
Plant culture...
... Analytica Chimica Acta for the
awarded bursary to present a paper at Euroanalysis
X (Basel, Switzerland). The authors thank the crew of
the R/V Belgica for their assistance during sampling,
and ... seawater
between an added metal chelating ligand (salicylal-
doxime) and naturally occurring dissolved organic
ligands have indicated that the establishment of an
equilibrium may take more than ... higher
salinity regions of estuaries and has been explained by
an increase in major cation concentrations. Suspended
particulate matter may consist of biological, organic
and mineral phases [5] and...