development of a recipe management system

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15
... Management Framework - Introd uced Marine Pests Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are ... results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a role in liaising with IMO, FAO, NACA to ... Introd uced Marine Pests Phase 1 – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management Framework  Conclusions,...
  • 10
  • 583
  • 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Ngày tải lên : 05/03/2014, 14:20
... spectroscopy has a very important role in studies of optical properties of materials. Our goal is to build a spectrometry system to measure weak optical signals such as Raman scattering and surface SH ... He-Ne laser instead of Ion Argon laser. The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser excitation. Acknowledgements: This work is supported by the Natural ... Key board, display board, Analog Input board, DSP Logic board and CPU and Power supply board. The DSP logic board takes a digital input from the A/ D converter on the Analog Input board and perform...
  • 6
  • 524
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Ngày tải lên : 12/09/2012, 15:05
... in nature to a data manager which fails to free data, but is easier to detect and prevent. • Data manager changes data. A malicious data manager may change the value of its data on each cache refresh. ... performed on a task. 3.4. External Memory Management An important part of the Mach strategy was a reworking of the basic concept of secondary storage. Instead of basing secondary storage around a kernel-supplied ... user programs through a message interface. This feature allows applications such as transaction management systems to participate in decisions regarding secondary storage management and page replacement. This...
  • 23
  • 1.3K
  • 1
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

Ngày tải lên : 03/04/2013, 21:07
... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy. Pizza and chocolate produced the strongest emotions based on Analysis of Variance. The terms active, adven- turous, affectionate, ... differentiating flavor variations of the same product. Data from this ballot were evaluated using Analysis of Variance (GLM procedure) in all future tests. Table 1 Consumer classification of emotions. ... techniques which are appropriate for the academic laboratory research might not be appropriate for commercial settings of consumer laboratories. Aca- demic laboratory research typically uses student...
  • 10
  • 781
  • 3
Tài liệu Real-World ASP.NET—Building a Content Management System pptx

Tài liệu Real-World ASP.NET—Building a Content Management System pptx

Ngày tải lên : 10/12/2013, 14:15
... content management application maintains all aspects of content components, and the metacontent management application maintains the same for metacontent. The content delivery application generates ... have, but you will find that some CMSs don't have a standard interface. The reason is that a lot of software that is a CMS, or that contains CMS functionality, came from different packages ... maintain, track, and find. It also provides a more secure way of storing your data. Having your data localized means you have a smaller area to protect from intruders. The more your data is...
  • 405
  • 716
  • 1
Tài liệu A Knowledge Management System for ERP Implementation pdf

Tài liệu A Knowledge Management System for ERP Implementation pdf

Ngày tải lên : 16/01/2014, 16:33
... It also represents an organizational infrastructure that affects how people work and imposes its own logic on a company’s strategy, organization and culture. After organizations accept the management ... of technology pre- paration and organizational change management. Although the importance of knowledge management (KM) in ERP implementation has been recognized, how to conduct knowledge management ... Industrial Man- agement and Data Systems 100(5–6): 261–270. Li L. 2000b. An analysis of the sources of competitive- ness and performance of Chinese manufacturers. International Journal of Operations...
  • 12
  • 622
  • 1
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Ngày tải lên : 24/01/2014, 00:20
... & Case Study A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation Francisco J. Forcadell 1 * and Fa ´ tima Guadamillas 2 1 Universidad Rey Juan Carlos, ... via overall external evaluations and detailed self-evaluation. The efforts made at the company over this period have been recognized by the receipt of a number of national and international awards. (4) ... Carlos, Madrid, Spain 2 Universidad de Castilla La Mancha, Spain A critical aspect of business management is the successful creation of processes which drive the development of a continuous flow of...
  • 10
  • 1.1K
  • 1
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Ngày tải lên : 18/02/2014, 17:20
... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirotake ... LEC, lymphatic endothelial cell; Lyve-1, lymphatic vessel endothelial hyaluronan receptor-1; MACS, magnetic-activated cell separation; MAPK, mitogen-activated protein kinase; PFA, paraformaldehyde;...
  • 11
  • 873
  • 0
Báo cáo "DEVELOPMENT OF HANOI BUS INFORMATION SYSTEM " pot

Báo cáo "DEVELOPMENT OF HANOI BUS INFORMATION SYSTEM " pot

Ngày tải lên : 05/03/2014, 16:20
... of 2 groups and 5 travel time parameters, and a bus geodatabase with 5 feature classes. The data management tool is designed as COM servers to extend standard functionality of ArcGIS software. ... bus geodatabase with 5 feature classes. For managing the geodatabase, a set of tools extending the capabilities of ArcGIS software via COM (Component Object Model) interface has been created. ... FROM LayerName WHERE [Name] = "FeatName" where LayerName is the name of layer containing searched features, FeatName is the name of these features. If the features are found, StSearch...
  • 12
  • 339
  • 0
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Ngày tải lên : 07/03/2014, 16:20
... (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); ... was performed on DNAse- treated RNA extracts. Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); ... expression vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAA AATGGAGC AGAAA CTCATCTC TGAAGAGGATCTG...
  • 14
  • 473
  • 0
Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Báo cáo "Development of a software package for 3D structured mesh generation " pdf

Ngày tải lên : 14/03/2014, 13:20
... interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects in the form of digitized ... viewing and presenting the topographic data and the generated meshes. The package has been applied to the generation of 3D computational meshes used as the input of a computational fluid dynamics ... Nguyen Van Thang, Nguyen Tat Thang, Development of a software for the simulation of atmospheric flows over complex topography, Proceedings of the 2005 Annual National Conference on Fluid Mechanics,...
  • 14
  • 402
  • 0
Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Báo cáo khoa học: The antagonistic effect of hydroxyl radical on the development of a hypersensitive response in tobacco pot

Ngày tải lên : 15/03/2014, 00:20
... ABA had a higher OH • level after ParA1 treatment. H 2 O, H 2 O pretreatment; H + ParA1, ParA1 infiltration after H 2 O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ... oligonucleotide prim- ers: 5¢-TGAATTC AATAATGTCTAACTTCCGCGCTCT- GTTC-3¢ and 5¢-AGGTACCTCAATGATGATGATGAT GATGATGCAGTGACGCGCACGTAGA-3¢. For the suc- cessful protein expression, a yeast expression consensus sequence ... glutathione from Roche (Basel, Switzerland). Catalase, SOD, ascorbic acid and ABA were purchased from Sigma (St Louis, MO, USA). All other mentioned reagents were of analytical grade. Plant culture...
  • 15
  • 479
  • 0
Development of a simple

Development of a simple

Ngày tải lên : 15/03/2014, 23:56
... Analytica Chimica Acta for the awarded bursary to present a paper at Euroanalysis X (Basel, Switzerland). The authors thank the crew of the R/V Belgica for their assistance during sampling, and ... seawater between an added metal chelating ligand (salicylal- doxime) and naturally occurring dissolved organic ligands have indicated that the establishment of an equilibrium may take more than ... higher salinity regions of estuaries and has been explained by an increase in major cation concentrations. Suspended particulate matter may consist of biological, organic and mineral phases [5] and...
  • 15
  • 410
  • 0

Xem thêm