development of a knowledge based system based on collaborative filtering recommendation for training knowledge sharing
development of a biosensor based on laser fabricated
... nm for the DNA concentration of 0.5 M According to the calibration, the increased deflection indicates that the cantilever bends downward, away from the DNA-coated side (the probe DNA is coated ... Hagan, A K Chakraborty, and A Majumdar, Proc Natl Acad Sci U.S .A 98, 1560 (2001) G Wu, R H Datar, K M Hansen, T Thundat, R J Cote, and A Majumdar, Nat Biotechnol 19, 856 (2001) C A Savran, T P Burg, ... acquisition system Only one of the cantilevers in the cantilever array is monitored since our current sensing system has only one light source and one PSD The environmental and electronic noises of...
- 3
- 351
- 0
Báo cáo khoa học: "Comparative antibody response of five recombinant antigens in related to bacterial shedding levels and development of serological diagnosis based on 35 kDa antigen for Mycobacterium avium subsp. Paratuberculosis" pot
... analyse-it.com) and, then ELISA based on 35 kDa antigen was compared with a commercial kit Material and Methods Antigen preparation Bacterial strains and plasmid E coli Top10 was used for Zero-Blunt and TA ... Banasure KD, Basagoudanavar SH, Chaudhury P, Tiwari V, Parihar NS, Goswami PP Identification and characterization of a gene encoding a 35-kDa protein from Mycobacterium avium subspecies paratuberculosis ... (sensitivity) against the false positive rate (1-specificity) that is obtained at each cut-off point) was constructed and the area under the curve (AUC) value was calculated as a measure of the accuracy of...
- 7
- 366
- 0
Development of a windows based computer aided die design system for die casting
... colleagues, Sun Yifeng, Du Xiaojun, Cao Jian, Saravanakumar Mohanraj, Atiqur Rahman and Low Leng Hwa Maria Financial assistance in the form of research scholarship from the National University of ... integration of CAD and CAE systems The integration of CAD and CAE systems is essential for the quick development of a low cost die, as well as to facilitate accuracy in simulation Both Zhang et al ... fixtures and cutting parameters for each process in the plan template based on the extracted information and available machining resources 2.7 Constraint -Based Modeling Constraint -based modeling...
- 121
- 649
- 0
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx
... proteins [26–32] Many of the post-translational modification pathways, such as phosphorylation, glycosylation, myristoylation and palmitoylation present in mammalian systems are also utilized in ... (Clontech Laboratories, Palo Alto, CA, USA) as a template PCR was carried out as described above using the forward primer (5¢-AATTCTGCAGTCGACGGT AC-3¢) and the reverse primer (5¢-GATTATGAATTCG AGTCGCGGCCGCTTTACTT-3¢) ... FRET was enhanced by the addition of a GnRH agonist but not by an antagonist (Fig 7), suggesting that the GnRH agonist facilitates receptor association Although the molecular basis of this action...
- 9
- 380
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... emaN ecneuqeS eborP esreveR drawroF eborP esreveR drawroF eborP esreveR drawroF '3-pxGCCAATTTCAGCCCAGGCACAAAm-'5 '3-TYCGGTTYGGGACCATGTT-'5 '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 ... 55/lizarb/oriezurc/4 2A rof ecneuqes ehT sniarts 21 eht rof dezylana saw noiger tegrat ehT )ASU ,ratsanD( erawtfos ratsanD eht gnisu dengila dna )1 elbaT( A C aisA 2TAS O O O O O O O O 55/lizarB/oriezurC/4 2A ... '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 B2 redaeL SERI noigeR seborp dna sremirp cificeps-VDMF...
- 6
- 347
- 0
Báo cáo y học: "Organizational readiness to change assessment (ORCA): Development of an instrument based on the Promoting Action on Research in Health Services (PARIHS) framework" pps
... subscale for which factors failed account for > = 50% of variance scales measuring clinical champion (as part of the facilitation scale), and availability of general resources (as part of the context ... manuscript All authors read and approved the final manuscript Additional material Additional file Annotated copy of the Organizational Readiness to Change Assessment (ORCA) This is an annotated ... focused on formal leadership, particularly in terms of teambuilding, and one focused on attitudes of opinion leaders for practice change in general (as a measure of informal leadership practice) One...
- 13
- 428
- 0
Development of a MACS based strategy for isolating rare cell populations from animal tissue for transcription factor studies
... research data available for blood cells mean that many of the blood cell population subsets have been isolated by MACS For example, MACS was used for the isolation of plasma cells, which are ... 2008; Makker, Agarwal et al 2008) (Grunewald, Paasch et al 2001; Said, Grunewald et al 2005; Grunewald, Paasch et al 2006) Conflicting observations have also been made Chemotherapy and radiotherapy ... done on these cells (Covassin, Amigo et al 2006).GFP tagging also enabled the purification of neuronal cells in C elegans (Von Stetina, Watson et al 2007) and of side populations from bone marrow...
- 382
- 295
- 0
Báo cáo hóa học: " Evaluation of a TDMA-based energy efficient MAC protocol for multiple capsule networks" pot
... Tdata is the time duration for data transmission Toh is the time duration for overhead transmission Tsync is the time duration for synchronization transmission and NR is TDMA resynchronization ... electrocardiography (ECG), images of the GI tract These sensors may have disparate sampling rate and sample data size For example, the pressure and temperature sampled data may be smaller in size and ... Communications and Networking 2011, 2011:54 http://jwcn.eurasipjournals.com/content/2011/1/54 Page of 12 Table Parameters for evaluating the multi-hop communications Parameters Value Parameters Area...
- 12
- 275
- 0
Development of a liposomal nanodelivery system for nevirapine ppsx
... F, Farkhondehfai A, Esmaeili F, Dinarvand R: Preparation of PEGylated nano liposomal formulation containing SN-38: in vitro characterization and in vivo biodistribution in mice Acta Pharma 2005, ... curvature by BAR domains on single liposome arrays Biophys J 2009, 96:57 0a- 57 0a 43 Ruckenstein E, Bhakta A: Effect of surfactant and salt concentration on the drainage and collapse of foams involving ... double distilled water was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove...
- 9
- 359
- 0
Báo cáo y học: " The development of a knowledge test of depression and its treatment for patients suffering from non-psychotic depression: a psychometric assessment" ppt
... less than on the Hamilton Rating Scale for Depression (HAM-7) [34] All patients were on antidepressant medication, and all had seen their clinicians on at least two occasions for standard treatment ... Knowledge of Biological treatments (antidepressants) Knowledge of the delayed onset of the action of antidepressants Ability to act appropriately to failed response to antidepressants Q17 Q21 Ability ... questions for the basic and clinical sciences 3rd edition Philadelphia, PA: National Board of Medical Examiners; 2001 Haladyna TM, Downing SM: A taxonomy of multiple-choice item-writing rules Appl...
- 15
- 416
- 0
Development of a telepresence manipulation system
... inspection and master-slave mechanical transportation and manipulation (called teleoperation) is considered Flexible robotic manipulators are considered for job of slave manipulation The ability ... DEVELOPMENT OF A TELEPRESENCE MANIPULATION SYSTEM WONG HONG YANG NATIONAL UNIVERSITY OF SINGAPORE 2001 Development of a Telepresence Manipulation System ABSTRACT In any teleoperated system, ... from a transmitter in a base location Magnetic receivers attached to the body provide positional and rotational data relative to the base (transmitter) Limitations of these trackers are a high latency...
- 108
- 579
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... performed in a closed one-tube system and avoids potential cross contamination during sample preparation for post-PCR analysis Real-time RT-PCR assays have been widely utilized for early diagnosis ... detection limit for the conventional RT-PCR assay was a 10-4 dilution of sample RNA Lanes 7: 10-fold dilution series of sample total RNA ranging from 10-1 to 10-7 dilutions; lane N: negative control ... control having no template; lane M: DL2000 DNA ladder Maker (TAKARA) ing temperature (Tm) The thermal profile for melting curve analysis consisted of a denaturation for at 95°C, lowered to 55°C for...
- 7
- 350
- 0
Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx
... ACTGTGTTTCCCATCCATTGG 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA AAGCTTTGAAATGGCAGAGGGAGGA GGATCCCGCCAGGAAGTGCTTTATTTGA 3084-3103 3122-3143 3098-3120 60 3008-3033 4637-4665 1658 VP3-1 VP3-2 Page of (page number ... precision) of the serially diluted pVP3 plasmid samples through transforming the raw data to their common logarithms and performing analysis of the mean coefficient of variation (CV) values of each ... Fang DY: Recommendation of GPV Veterinary Science in China 1962, 8:19-20 (in chinese) Takehara K, Nishio T, Hayashi Y, Kanda J, Sasaki M, Abe N, Hiraizumi M, Saito S, Yamada T, Haritani M: An...
- 7
- 338
- 0
Development of a graphic user interface based on OpenGL for a drop on demand micro bio fabrication system
... interfaces or text navigation, a GUI has established a model containing the information and actions, and also supplied availabilities of operation to a user through visual indicators and graphical ... object-oriented language [22], exists as part of Visual Studio NET, a package that contains a platform for developing application for the Windows family of operating systems Unlike other programming languages, ... photo masks which are commonly used in traditional image printing manufacturing The noncontact process eliminates any wear and tear on the print head 2.1.2 Disadvantages of inkjet printing As inkjet...
- 78
- 383
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
- 13
- 456
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... To accomplish this goal, we repeatedly passaged the liver homogenates of MARV-infected scid mice and then Mouse adaptation The general approach to adapt MARV to mice was based on virus passage...
- 13
- 431
- 0
Báo cáo hóa học: " Computationally Efficient Direction-of-Arrival Estimation Based on Partial A Priori Knowledge of Signal Sources" ppt
... method for DOA estimation In Section 4, numerical results are given Finally, conclusions are drawn in Section PROBLEM FORMULATION 2.1 Data model Consider a uniform linear array (ULA) composed of ... computationally attractive and can be used in the case of small samples where the array covariance matrix cannot be estimated efficiently While operationally similar to the classical MUSIC estimator, ... the forward recursion of the MSWF to find a subspace of interest and use that subspace to calculate a reduced-rank data matrix and a reducedrank weight vector for a reduced-rank autoregressive (AR)...
- 7
- 221
- 0
Báo cáo hóa học: " FPGA Implementation of an MUD Based on Cascade Filters for a WCDMA System" doc
... number of adaptation iterations is 100(256/OVSF) for each user k of the signature and detection block We used the same number of adaptation iterations for hardware estimation While the allowed adaptation ... Pacific on Design Automation Conference (ASP-DAC ’00), pp 3–4, Yokohama, Japan, January 2000 G Xu, S Rajagopal, J R Cavallaro, and B Aazhang, “VLSI implementation of the multistage detector for next ... signature n−1 n n+1 PELMS PELMS PELMS Filtering Adaptation Filtering Adaptation Filtering Adaptation Block detection Idle ··· ··· Filtering Adapt Idle Filtering Adapt Idle Filtering Adapt Idle tA...
- 12
- 388
- 0
Development and application of a web based kanban system
... manufacturing 2.3 The Traditional Kanban System The traditional Kanban system, also know as a dual-card Kanban system, is an information system that controls and regulates the manufacturing of ... for a manufacturing company that aims to improve and enhance their manufacturing system and operations The major advantages of a Web -based Kanban system is the availability of visible and real-time ... Similar to a withdrawal Kanban except that that the retrieval of Subcontract Kanban materials is from a factory or storage location near the actual manufacturing plant Express Kanban Auxiliary Kanban...
- 78
- 391
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008