0

toward disaster resilient communities a new approach for south asia and africa

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates for the rapid and sensitive ... 2007 The Authors Journal compilation ª 2007 FEBS N Zaidi et al Parallel detection of CatE and CatD activity TAPA and specific catalytic activities of CatE and CatD were determined fluorimetrically...
  • 12
  • 645
  • 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học

... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted...
  • 9
  • 356
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo khoa học

... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for nonstationary signal analysis ... Krishnan, R M Rangayyan, G D Bell, and C B Frank, “Adaptive time-frequency analysis of knee joint vibroarthrographic signals for noninvasive screening of articular cartilage pathology,” IEEE Trans ... of Calgary, Calgary, Alberta, Canada, in 1996 and 1999, respectively He joined Ryerson University, Toronto, Ontario, in 1999 as an Assistant Professor in electrical and computer engineering, and...
  • 8
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo khoa học

... incubated for 4–5 days and matured for 20–24 h and analyzed for mature DC content and function as above Determination of mDC yield and phenotype Isolated cells were washed in DC-CM and viable ... 3H-thymidine was added to each well and the plates harvested 18 h later Irradiated PBMC from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of ... harvested and stained for DC maturation markers without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating...
  • 11
  • 469
  • 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

Tiến sĩ

... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
  • 144
  • 306
  • 0
A New Vision for Adolescent Sexual and Reproductive Health pot

A New Vision for Adolescent Sexual and Reproductive Health pot

Sức khỏe phụ nữ

... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... methods than are their American peers As noted, they are less likely to be poor and they have greater access to sexual and reproductive health care services Dutch policy makers and health care providers,...
  • 7
  • 662
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

Hóa học - Dầu khí

... Statistical Analyses Part One Functional Movement Screen Data was coded using Stata 8.0 For exploratory data analysis we used bivariate methods The primary hypothesis was assessed with multivariate analysis ... activities and were on a full duty status Age at time of the study ranged from 21 to 60 years with a mean of 41.8 years for males and 37.4 years for females The subjects were 408 male (94.2 percent) and ... fire department database, and other selected parameters (age, gender, tenure and rank) http://www.occup-med.com/content/2/1/3 icine physician, therapist, and fire department health and safety officer)...
  • 9
  • 468
  • 0
báo cáo hóa học:

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Hóa học - Dầu khí

... increased collaboration and integration of TB and HIV programs and services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional Healthcare Providers A critically ... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS: ... collaboration between HIV and TB programs and integrating services is underway The World Health Organization (WHO) has formulated recommendations regarding collaboration and integration and has...
  • 5
  • 469
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf

Hóa học - Dầu khí

... IEEE International Symposium on Circuits and Systems, pp 434–437, Sydney, Australia, May 2001 [17] C C Tseng, “Eigenfilter approach for the design of variable fractional delay FIR and all-pass filters,” ... International Symposium on Circuits and Systems, pp 2641–2645, May 1998 [7] T I Laakso, V V¨ lim¨ ki, M Karjalainen, and U K Laine, a a “Splitting the unit: delay tools for fractional delay filter ... Step Calculate rb , Qb in (17) and replace a0 by ak Then go to Step EURASIP Journal on Advances in Signal Processing and the respective inner iterations are three and two in the first and second...
  • 10
  • 490
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Hóa học - Dầu khí

... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... conservation can continue and no changes are made that are irreversible If the results from a digital approach are not acceptable, the more challenging and expensive physical approach can still be applied ... International Conference on Computer Graphics and Interactive Techniques in Australasia and Southeast Asia (GRAPHITE ’05), pp 135–138, ACM, Dunedin, New Zealand, November-December 2005 Y M Govaerts,...
  • 13
  • 569
  • 0
Báo cáo y học:

Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx

Báo cáo khoa học

... well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were performed ... housed at BIOQUAL, Inc Rockville, MD, according to standards and guidelines as set forth in the Animal Welfare Act and The Guide for the Care and Use of Page 14 of 19 Laboratory Animals, as well as ... pre- and post-raltegravir viral load measurements was done Viral load values at Day 0, Day and Day 10 were compared with viral loads at 27 and 166 days prior to treatment start Significant differences...
  • 19
  • 317
  • 0
Tài liệu UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 2. ONLINE COMMUNITIES FOR DEVELOPMENTNOTE ppt

Tài liệu UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 2. ONLINE COMMUNITIES FOR DEVELOPMENTNOTE ppt

Cơ sở dữ liệu

... build and share knowledge with each other, and care about learning and sharing to increase and make knowledge useful for a purpose • Communities allow groups to create and deploy advocacy action across ... situation APC Africa Women takes a more focused approach around women’s issues, and focuses on the inform and educate roles, and then activates through specific events http://www.apcafricawomen.org/achievements.shtml ... time and with a wide variety of participants • Communities can help people: identifying issues, informing and educating, communicating and activating for action, measuring and revising advocacy actions...
  • 12
  • 327
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Question Answering as Question-Biased Term Extraction: A New Approach toward Multilingual QA" doc

Báo cáo khoa học

... paragraphs Table 3: Answer Extraction from Top N documents Feature set Match TE (DF) Top N paragraphs Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact Partial Exact ... evaluation Automatic evaluation consists of exact matching and partial matching Partial matching is useful for absorbing the variation in extraction range A partial match is judged correct if a system’s ... (NICT), Japan A machine learning approach to hierarchical question analysis was reported in (Suzuki et al., 2003), but training and maintaining an answer extractor for question types of fine granularity...
  • 8
  • 357
  • 0
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 3. KEY FACTORS FOR A SUCCESSFUL ONLINE COMMUNITYNOTE pptx

UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 3. KEY FACTORS FOR A SUCCESSFUL ONLINE COMMUNITYNOTE pptx

Cơ sở dữ liệu

... social, cultural, environmental, organizational and technical factors • The social and cultural factors that mostly influence a community are: Identity, Membership, Language, Attention, Power and ... factors, starting with social and cultural Online Communities: a new opportunity - Key factors for a successful online community - page Social and cultural factors Community is a social interaction ... community - page Social and cultural factors Power and control are familiar issues offline Online, however, where we can’t see each other’s body language and tone, issues of power and control can feel...
  • 12
  • 346
  • 1
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 4. ELECTRONIC NETWORKING IN COMMUNICATION FOR DEVELOPMENTNOTE pptx

UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 4. ELECTRONIC NETWORKING IN COMMUNICATION FOR DEVELOPMENTNOTE pptx

Cơ sở dữ liệu

... The table below summarizes some communication aspects of the hierarchical and participatory approaches HIERARCHICAL MODELS PARTICIPATORY APPROACHES Behavioural causes Structural causes Vertical ... development needs and perceptions and facilitate the merging of global and local knowledge and information Support, create and strengthen interactive and collaborative networks that enable information to ... communication for development “mix” of traditional and/ or appropriate media; • where accessible, these new media have features that enable bottom-up articulation and sharing of information on needs and...
  • 20
  • 272
  • 0
A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

A New Formula for Child Health: Doctors Communities + Healthy Kids pdf

Sức khỏe trẻ em

... booth and other health and safety games and arts booths Another parent was in charge of sharing information about the health fair at Café el Director, a monthly bilingual L to R: Juanita (with granddaughter ... local radio station 1430AM and operates the Diaspora Newspaper in the Greater Sacramento region The only group of its kind in the area, Afisha is a major source of news and information for the ... health This project is a collaboration between St Andrews Hospital and Health Care Center, the Boothbay YMCA, and the Boothbay Schools -Courtesy of American Academy of Pediatrics CATCH Database...
  • 94
  • 252
  • 0
A new approach to financial regulation: the blueprint for reform potx

A new approach to financial regulation: the blueprint for reform potx

Tài chính doanh nghiệp

... Bank and the FSA are engaging in Europe and with international partners on this and other crucial issues A new approach to financial regulation 1.13 The Government’s primary objective in reforming ... undertake, as far as possible before formal legal powers are created, the permanent body’s macro-prudential role, in addition to vital preparatory work and analysis into potential macro-prudential ... have any comments on the governance, accountability and transparency arrangements proposed for the FCA, as described above and in Chapters and 4? Coordination and regulatory processes 2.133 As...
  • 413
  • 413
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot

Hóa học - Dầu khí

... only a few nodes are GPS enabled and are capable of finding their own location using GPS A few special nodes are equipped with antennas which can measure RSSI and the angle of arrival (AOA) of ... reliable data sharing and communication between highly mobile vehicles i.e., VANETs for the present and in the future List of Abbreviations AOA: angle of arrival; CAT: Cluster Adjacency Table; ... cluster head relieves finally after broadcasting new cluster head ID Mangai and Tamilarasi EURASIP Journal on Wireless Communications and Networking 2011, 2011:18 http://jwcn.eurasipjournals.com/content/2011/1/18...
  • 10
  • 482
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Kỹ năng đọc tiếng Anh

... comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid Compound was obtained (crystalline ... tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated without purification The mixture of diols 22 so obtained was oxidized ... group at C14, to install the oxo group at C-3 and the allyl group at C-8 The intermediate would then be dehydrogenated and the product subjected to methylation to afford Danishefsky4b,d and Mehta14...
  • 3
  • 547
  • 0
Báo cáo y học:

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Y học thưởng thức

... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... kinetics and bioavailability Intravenous, oral and rectal administration Cancer Chemother Pharmacol 1982;8:93-98 Jaeger H, Russmann D, Rasper J, Blome J Comparative study of the bioavailability and ... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the...
  • 11
  • 715
  • 0

Xem thêm

Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008