a new approach for the morphological segmentation of highresolution satellite imagery

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Ngày tải lên : 11/08/2014, 10:23
... matura- tion (Fig. 2). The viability of the harvested mature DC from the roller bottles and static flasks was also assessed using 7-AAD staining of the cells prior to FACS analysis. In both cases, ... large scale. Thus, this approach is a novel application that increases the versatlity of this tech- nology and broadens its application in vaccine manifac- turing. In addition, the mDC generated ... surfaces stacked on top of each other in a single large flask format. The cells are seeded into a main port and distributed over the multiple stacked surface areas. We have found however that these...
  • 11
  • 469
  • 0
Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

Báo cáo khoa học: "A new method for the histochemical localization of laccase in Rhus verniciflua Stokes" docx

Ngày tải lên : 09/08/2014, 03:24
... numerous other woody plants including Aesculus sp., Prunus persica, Acer pseudoplatanus and many species of the Anacardiaceae family, and in a number of fungi as well as in ... A new method for the histochemical localization of laccase in Rhus verniciflua Stokes M.R. Li* Department of Forestry and Natural Resources, University of Edinburgh, The ... !I"BIIQ"O the inactivation of the enzyme during extraction and purification; its substrate, urushiol, is apparently necessary for main- taining it in an undenatured state (Guo, 1981...
  • 4
  • 355
  • 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Ngày tải lên : 08/03/2014, 18:20
... give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated ... Sciences and Humanities Research Council of Canada. [1] Reduplication is a word formation process involving the repetition of a word or a part of a word. As an example, in Warlpiri there is a process...
  • 8
  • 522
  • 0
Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Báo cáo khoa học: "Parsing the Internal Structure of Words: A New Paradigm for Chinese Word Segmentation" doc

Ngày tải lên : 17/03/2014, 00:20
... 8: The actual output of our parser trained with a fully annotated treebank. the information of the proposed output for the new 1408 tant reason these labels are used is we want to com- pare the ... for phrase labels is close to this accuracy. Besides, the result for flat labels compares favorably with the state of the art accuracy of about 93% F 1 for joint word segmen- tation and part -of- speech ... Processing of the AFNLP, pages 522–530, Suntec, Singapore, Au- gust. Association for Computational Linguistics. Canasai Kruengkrai, Kiyotaka Uchimoto, Jun’ichi Kazama, Yiou Wang, Kentaro Torisawa, and...
  • 10
  • 476
  • 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Ngày tải lên : 22/03/2014, 21:20
... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the ... 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted into the SalI–BamHI sites of pGK425 [19], yielding plasmids pLMZ-WT and pLMZ-K3 5A, respectively. The...
  • 9
  • 356
  • 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Ngày tải lên : 24/03/2014, 03:20
... Nonliteral precision and recall are de- fined similarly. Average precision is the average of literal and nonliteral precision; similarly for av- erage recall. For overall performance, we take the f-score ... discuss the structure and contents of the exam- ple base and the potential for expansion. After an initial run for a particular target word, we have the cluster results plus a record of the feedback ... University Burnaby, BC, V 5A 1S6, Canada jbirke@alumni.sfu.ca, anoop@cs.sfu.ca Abstract In this paper we present TroFi (Trope Finder), a system for automatically classi- fying literal and nonliteral usages of...
  • 8
  • 447
  • 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

Ngày tải lên : 18/06/2014, 15:20
... Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot study of autologous transplantation of bone ... Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone- marrow cells: a pilot study and a randomised controlled trial. Lancet ... acceptance criteria for the migration capacity of BM-MNC in cardiac regeneration. Cell migration and cell invasion assays measure the ability of certain cell types to move through a porous membrane toward a...
  • 9
  • 773
  • 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot

Ngày tải lên : 20/06/2014, 08:20
... TB Program Collaboration of Programs National HIV Program National HIV Program A Common TB and HIV Paradigm An Alternative TB and HIV Paradigm TB Services HIV Services C&T Antiretrovirals Ol Rx and Px Adherence ... integration of TB and HIV care and treatment are highly encouraging while at the same time their examples highlight the technical, program- matic, staffing and scale-up challenges that remain and demonstrate ... supply of antiretroviral therapy. Finally, national TB and HIV programs in many countries may have limited authority to implement col- laborative models of care, either at the national or local level. Action...
  • 5
  • 469
  • 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Ngày tải lên : 21/06/2014, 20:20
... capture the information in each of the negatives of a large collection before the damage causes a complete and irretrievable loss of information. 2.1. Restoration Approaches. The primary approach ... vertical Gaussian stripes. The initial pass is captured with only the display device in the scene to acquire a base case for the Gaussian parameters σ and X 0 .Thenext pass of the stripes is captured ... when an image is captured. However, limited dynamic range of the CCD and quantization in the Analog/Digital conversion often lead to data loss that typically appears as saturation. 8 EURASIP...
  • 13
  • 569
  • 0
Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Ngày tải lên : 23/06/2014, 01:20
... difficulties because the derivative of the phase of the signal may take negative values thus misleading the interpretation of instantaneous frequency. In this paper, a novel approach to extract the IF ... particular the frequency of the spectral peaks) are varying with time. These signals are often referred to as nonstationary signals. A chirp signal is a simple exam- ple of a nonstationary signal, ... fre- quency, then the IF need not be a frequency that appears in the spectrum of the signal. If the IF is interpreted as the derivative of the phase, then the IF can extend beyond the spectral range of the...
  • 8
  • 355
  • 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Ngày tải lên : 09/08/2014, 07:21
... hospitalization. The postoperative course was complicated by the formation of a subhepatic abscess that was successfully treated with drainage cathe- ters and systemic antibiotics. Imatinib was ... cells of Cajal [1]. They affect mostly males between the ages of 50 and 70, and are usually found inci- dentally at early stages [1-4]. Large or advanced lesions may present with a variety of clinical ... reducing the tumor size and facilitating surgical resection. Conclusion: A well-planned multidisciplinary approach should be part of the standard management of advanced or metastatic GIST. Background Gastrointestinal...
  • 4
  • 454
  • 0

Xem thêm