... PMC and SDC All authors read and approved the final manuscript Acknowledgments This research was supported by The French National Agency for Aids Research (ANRS, France), the charity organization ... visit thereafter was defined as the injection of any drug in the months before that visit Clinical and laboratory data on viral load, CD4 T-cell counts and data on HIV clinical stage, with stage ... individuals Finally, although a statistical adjustment was made to allow for non-random assignment to medication type, this study was not a controlled clinical trial and further investigations are...
... ensure greater generalization of therapeutic effects Following the idea of Pelham’s summer treatment approach, also in Germany and Japan Intensive-Behavioural Treatment approaches have been developed ... training, parent-child interaction therapy, cognitive-behavioural approaches, and other multimodal approaches are more effective than individual psychodynamic or traditional unfocused and open-ended ... combination of several components of psychotherapeutic interventions, case management as well as pharmacological and educational intervention Thus, the optimum method appears to be an integrated approach...
... Laboratory, Lawrence Berkeley National Laboratory, Sandia National Laboratories, Los Alamos National Laboratory, National Renewable Energy Laboratory, Argonne National Laboratory, Oak Ridge National ... technical area is a major collaborative effort of the individual partners, the national laboratories, and a few universities The Pacific Northwest National Laboratory, Lawrence Livermore National Laboratory, ... SUSANNA CLARENDON, Financial Associate PANOLA GOLSON, Project Assistant ANA-MARIA IGNAT, Project Assistant SHANNA LIBERMAN, Project Assistant NAE = National Academy of Engineering viii Acknowledgments...
... enough to allow comparative advantages to last for extended periods The advent of technology as a major tradeable asset has radically changed the dynamics of trade among nations What the centuries’ ... plan for and thereby make the transition to the next major technology, the smart phone, where not just basic design and manufacturing are important Operating and other software, for example, are ... largely determined by endowed assets (arable land, navigable water ways, minerals deposits, etc.) The fact that these assets were available in at most slowly changing quantities facilitated the...
... Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and Technology ... such as the characterization of wind fields and the evaluation of the performance of the building envelope (AAWE, 199 7a) Two critical questions regarding theneedfor an LSWTF (as opposed to the ... to an LSWTF are available that could potentially provide much of the same data A variety of tools for research on wind-resistant structures are available, including analysis, numerical computation,...
... designs for PDSA quality improvement research Qual Manag Health Care 2004, 13(1):17-32 Wolf MM, Kirigin KA, Fixsen DL, Blase KA, Braukmann CJ: The Teaching-Family Model: A case study in data-based ... control theory were significantly more effective than the other interventions, an effect that would have been missed using traditional meta-analyses A similar approach has been used by Chorpita, Daleiden, ... techniques; all in as much detail as is possible, unless these details are already readily available (e.g., in a prior publication) Access to intervention manuals/protocols At the time of publishing a...
... designs for PDSA quality improvement research Qual Manag Health Care 2004, 13(1):17-32 Wolf MM, Kirigin KA, Fixsen DL, Blase KA, Braukmann CJ: The Teaching-Family Model: A case study in data-based ... control theory were significantly more effective than the other interventions, an effect that would have been missed using traditional meta-analyses A similar approach has been used by Chorpita, Daleiden, ... techniques; all in as much detail as is possible, unless these details are already readily available (e.g., in a prior publication) Access to intervention manuals/protocols At the time of publishing a...
... Start with a plan As part of that, you make sure each table contains unique data For example, a table of asset data won’t contain sales information, and a table of payroll data can’t contain ... enable the relationships among your tables Design tables fora web database — a database you publish to a Microsoft® SharePoint® site Design the tables foranew database Start with a plan For ... the tables and relationships foranew database Course goals Plan the table structure of anew database Plan the fields — the individual columns in each table Plan the primary key fields that...
... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target cells was determined by the number of colonies retaining the target gene divided by that of total ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the...
... regulation of the applicant (the PRA for dual-regulated firms, and the FCA for all others) will manage the application process and ultimately grant permission For dual-regulated firms, the PRA will ... enabling macro-prudential regulation at the national level The Government, the Bank and the FSA are engaging in Europe and with international partners on this and other crucial issues Anewapproach ... establishing a governance and accountability framework forthe FCA that replicates the arrangements forthe FSA where appropriate, and strengthens them where possible The proposals outlined in the...
... without fixation Immediately before FACS analysis µg/ml 7-ADD was added as viability indicator The dot plots shown the total cells in the floating fractions with the CD83+, 7-AAD- and CD83+, 7-AAD+ ... surface area used during the loading process in the bottles allows the monocytes to roll along and stay in close contact with the surface and then eventually attach This is akin to the attachment ... from the original DC donor were also used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases,...
... compound was available fora direct comparison To complete the formal synthesis of guanacastepene A (1), diol 24 was dissolved in acetone and treated with a catalytic amount of p-toluenesulfonic acid ... °C, h and then HMPA, MeI, À20 °C, h, 98% p-toluenesulfonic acid as the catalyst and methyl orthoformate as the water scavenger, at room temperature, afforded the corresponding ethylene ketal Hydrolysis ... Danishefsky4b,d and Mehta14 have shown that methylation of similar a, b-unsaturated ketones introduces the methyl group in a trans-orientation with respect to the angular methyl group The allyl and oxo...
... performed as basis fora sound risk assessment [43] The stated deficits in the GMO dossiers and a series of publications that argue against a wider application of the ecological approach in ERA ... this approach as contentious They note that “careful consideration needs to be given to how the expert and lay panels are constructed and managed in the qualitative assessment phase” to lead to the ... “ecotoxicological approach and an “environmental approach can be characterised The basic distinction between their proponents is their degree of institutional and educational attachment to the development...
... approaches to implementing a transformation: the Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor ... as the Kaplan and Norton “balanced scorecard” (1992) and “strategy map” (2000) in both the transformationstrategy development and the performance-measurement phases of a transformation The balance ... transformation of the organization They are only a means for identifying problem areas and for planning subsequent transformation actions The literature of organizational change clearly reveals...
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with the ... cathepsin D activity J Pept Sci 11, 166–174 31 Yasuda Y, Kageyama T, Akamine A, Shibata M, Kominami E, Uchiyama Y & Yamamoto K (1999) Characterization of new fluorogenic substrates forthe rapid and sensitive...
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' This example ... HG1'17 al8 g~ T{P-J~IR~ MA~.n all MAJLIf d P~ all ~UA ~ liB! PIO jI M@AJUf| WJA ~UA (b) Figure 2a is the phonological representation forthe sentence: ngarrka.ngku.ka marlu marna.kurra luwa.rnu ngarni.nja.kurra ... well-formed Also exemplary of the division of duty between the morphophonological parser and the syntactic parser is the dual status of subcategorization in Warlpiri For example, the ergative case...
... only As regards the second aim, the TCj which accompany a current word may reveal that it could be a possible indicator of a main clause, or subordinate clause, or a phrase If such is the case, an ... which allow forthe simultaneous retrieval of information along several channels When the extended address α attached to t is reached during transit of the glossary, the routine searches forthe ... are counted and examined for indications anent its physical make-up For instance, the machine examines whether the occurrence is a word, or perhaps, a punctuation mark, formula, etc If a word, it...
... War Bonds in the Second World War: A Model foraNew Iraq/Afghanistan War Bond? Summary The high costs of fighting the wars in Iraq and Afghanistan have rekindled congressional interest in the ... States War Bonds to aid in funding of the operations in Iraq and Afghanistan.” All three bills are similar and state that the authorized war bonds “shall be in such form and denominations, and ... that accrue earnings based on both a fixed rate of return and a semiannual inflation rate A single, annual rate, called the composite rate, reflects the combined effects of the fixed rate and the...
... of the nominal variables, although they have a procyclical appearance Overall, the application makes clear that the proposed extended framework allows fora formal analysis of various key aspects ... variables, although they have a procyclical appearance Overall, the application makes clear that the proposed extended framework allows fora formal analysis of various key aspects of potential ... euro area wide data are drawn from official sources such as Eurostat or the European Commission Historical data for euro area-wide aggregates were largely taken from the Area-Wide Model (AWM) database...