0

activating a particle effect on a mouse event

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học

... histological analyses Conventional hematoxylin and eosin stain was performed FEBS Journal 278 (2011) 3119–3129 ª 2011 The Authors Journal compilation ª 2011 FEBS E A Karavia et al in order to evaluate ... Journal compilation ª 2011 FEBS 3125 Apolipoprotein E and diet-induced NAFLD E A Karavia et al possibility is that the effects of apoE on hepatic lipid accumulation are mediated by LDLr-related protein ... (mice containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the maintenance of plasma lipid homeostasis, apoE plays a central...
  • 11
  • 544
  • 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Ngân hàng - Tín dụng

... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... euro area …nancial system an impaired provision of credit by banks could have severe ampli…cations on real economic activity and in‡ ation The monetary policy actions taken by the ECB (and other ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3,...
  • 30
  • 911
  • 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo khoa học

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTGATGTGGTTCATC-3¢ (PstI-HindIII) ... CTGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAA AAGCTTAATATTGTTGTGATGTGGTTCATC-3¢ (PstIHindIII); Pfg27B: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTG TGATGTGGTTCATC-3¢ (PstI); Pfg27C: 5¢-AAAAAGC...
  • 5
  • 435
  • 0
Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

Ngân hàng - Tín dụng

... afternoon, three days after the Thursday auction The other pair of tickets was to a regular season baseball game, between the Red ALWAYS LEAVE HOME Sox and the Toronto Blue Jays There was also a consolation ... tables in a large meeting room As a break between the orientation activities, they were invited to purchase a dinner certi®cate at a nearby restaurant The restaurant is a local landmark and is within ... entertain more complex ®nancial explanations (e.g., maintaining some precautionary cash balances, and so forth), it seems implausible that our respondents would accept loans at the high exchange rates...
  • 8
  • 344
  • 0
báo cáo hóa học:

báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

Hóa học - Dầu khí

... Sayah S, Patte C, Gasque P, Chan P, Ischenko A, Vaudry H, Fontaine M: Characterization of rat C 5a anaphylatoxin receptor (C5aR): cloning of rat C5aR cDNA and study of C5aR expression by rat astrocytes ... showing that the response was specific Thus, the NGF mRNA increase acted via the anaphylatoxins/anaphylatoxin receptors and was not due to contaminants in anaphylatoxin preparations Analysis of ... sense [AGG TGC ATA GCG TAA TGT CC], NGF antisense [CCT TGA CAA AGG TGT GAG TC], GAPDH sense [TGC CAT CAA CGA CCC CTT CA] and GAPDH antisense [TGA CCT TGC CCA CAG CCT TG] The theoretical size was...
  • 10
  • 777
  • 0
báo cáo hóa học:

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

Hóa học - Dầu khí

... SM, Holtzman DM: Peripheral anti -A beta antibody alters CNS and plasma A beta clearance and decreases brain A beta burden in a mouse model of Alzheimer's disease Proc Natl Acad Sci U S A 2001, ... http://www.jneuroinflammation.com/content/3/1/17 mice, coronal sections of each mouse hemibrain were analyzed for changes in immunostained A plaque loads Quantitative image analysis of amyloid plaque burden in all ... indicate that there is the potential of exacerbation of cerebral-amyloid angiopathy (CAA) associated microhemmorhages in certain mouse strains following passive immunization with certain anti -A antibodies...
  • 13
  • 410
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Hóa học - Dầu khí

... NS/1 6A( 5U) NS/1 6A( 6U) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA ... AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA)...
  • 11
  • 427
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp:"The extreme drought in the 1920s and its effect on tree growth deduced from tree ring analysis: a case study in North China" ppsx

Báo cáo khoa học

... typical steppe Thus, a tree-ring database covering a broad range of spatial and temporal scales may provide an alternative approach to assess and understand the stand dynamics of the remnant Meyer ... (HHT) in an agro-pastoral ecotone of central Inner Mongolia, and one Korean spruce (Picea koraiensis Nakai) chronology (BYAB) from a forest-steppe ecotone in eastern Inner Mongolia Thus, another ... 10 km is situated along the middle reaches of the Xilin River Perennial and annual grasses are dominant in this region and form a typical steppe landscape A patch (about ha) of natural Meyer spruce...
  • 8
  • 396
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Ectomycorrhization of Acacia holosericea A. Cunn. ex G. Don by Pisolithus spp. in Senegal: Effect on plant growth and on the root-knot nematode Meloidogyne javanica Robin Duponnois" potx

Báo cáo khoa học

... semi-arid tropical Africa [8, 9, 17] The Acacia species remain very abundant in savannas and arid regions of Australia, Africa, India and the Americas They generally are dependent on mycorrhizae ... mineral nutrient concentrations [2] This biological effect was demonstrated for other Australian acacia species such as Ectomycorrhization of Acacia holosericea in Senegal A mangium [16] The mean ... camaldulensis plantations whereas one was associated with A mangium, one with Casuarina equisetifolia and two with A holosericea Compatibility tests performed under axenic conditions between A...
  • 6
  • 348
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Flowering and cone production variability and its effect on parental balance in a Scots pine clonal seed orchard" docx

Báo cáo khoa học

... of a crown (with male vs female flowers) of a plus tree may increase maleness variation among ramets (within clones) and finally may cause negative environmental correlations On the other hand, ... female parents were calculated as: N e(m) / and / = ), i Σ(p e(f) N = ), i Σ(c respectively Sexual asymmetry of clonal contribution obtained from a one-way ANOVA and multivariate analysis ... was calculated on pollen and seed cone production averaged over the years of observation It was also calculated on pollen production in 1988 and seed cone yield in 1989 and also on pollen and...
  • 16
  • 352
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx

Báo cáo khoa học

... damage (Fig 1E) Fractionated radiation caused less mucosal damage than the same total dose given as a single fraction This damage-sparing effect by fractionating the radiation was retained also ... histological analysis: radiation alone (n = 4), 5-FU alone (n = 1), oxaliplatin alone (n = 6), radiation + 5-FU (n = 2), radiation + oxaliplatin (n = 3), radiation + 5-FU + oxaliplatin (n = 2) and ... oxaliplatin dose = mg/kg Abbreviations: oxa = oxaliplatin Special thanks to Margaretha Olsson and Christina Boll for all help with breeding and treating the animals and jejunal sample preparation...
  • 7
  • 298
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " The influence of tumor oxygenation on 18F-FDG (Fluorine-18 Deoxyglucose) uptake: A mouse study " pps

Báo cáo khoa học

... greatest change in 18F-FDG uptake, which is where a radiation oncologist would presumably concentrate three-dimensional conformal radiation dose painting, has significant implications for cancer ... diameter tumors were used PET scanner PET images were obtained with the ATLAS (Advanced Technology Laboratory Animal Scanner), a dedicated small animal PET scanner developed at NIH with an axial ... Radiation Oncology 2006, 1:3 tion was estimated and used for normalization as described below PET images at early time points revealed a large vessel dorsal and/or caudal to the heart Comparison...
  • 9
  • 318
  • 0
Báo cáo y học:

Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc

Báo cáo khoa học

... factors that were modifiable posttrauma (e.g social bonds and social isolation can be acted on and enhanced after someone has experienced a traumatic event; whereas pre -event trait anxiety cannot), ... those approached may have passed the information on to others Some approaches were made to organisations, and may or may not have been read by the relevant individuals Reasons for refusal included ... support, as they address only actions which may be useful after a traumatic event The trauma may have ongoing effects regardless of intervention or the person may show few long term effects and recover...
  • 15
  • 342
  • 0
Báo cáo y học:

Báo cáo y học: "Hepatitis B virus core protein with hot-spot mutations inhibit MxA gene transcription but has no effect on inhibition of virus replication by interferon a" pptx

Báo cáo khoa học

... (experimental group)] Real-time analysis of MxA mRNA and HBV DNA levels Determination of hepatitis B surface antigen (HBsAg) For real-time analysis of MxA mRNA detection, 500 ng of total RNA were converted ... the antibody (anti-Flag, 1:3000; poly-anti-rabbit b-actin, 1:500) The monoclonal anti-Flag antibody was purchased from the Invitrogen Company and poly-anti-rabbit b-actin antibody was purchased ... group)]/mean (control group) Statistics Results are reported as means ± standard deviation (SD) Differences among groups were tested for significance by one-way analysis of variance (ANOVA) Values of...
  • 6
  • 351
  • 0
Báo cáo y học:

Báo cáo y học: "The SLC2A9 non-synonymous Arg265His variant and gout; evidence for a population-specific effect on severit" docx

Báo cáo khoa học

... Sanna S, Maschio A, Busonero F, Usala G, Mulas A, Lai S, Dei M, Orrù M, Albai G, Bandinelli S, Schlessinger D, Lakatta E, Scuteri A, Najjar SS, Guralnik J, Naitza S, Crisponi L, Cao A, Abecasis ... simplest conclusion is that the C-allele of rs3733591 has a weaker effect on gout per se in Caucasian and Polynesian populations than in the Asian and Melanesian populations studied thus far However ... Zealand Jade Hollis-Moffatt was supported by a New Zealand National Heart Foundation Research Fellowship Amanda Phipps-Green, Marilyn Merriman and Ruth Topless are thanked for expert technical...
  • 25
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

Báo cáo khoa học

... potassium concentration gradients and this independence of sodium pumping can make it act as an important safety feature against involuntary, or spastic, skeletal muscle contraction Page of Kurbel ... concentration So, if the intracellular pH is normal, similar Donnan effects on chloride ions can be expected in all Cl permeable cells The consequence is that similar intra- and extra-cellular ... concentrations of plasma proteins mean that even greater hydrostatic pressure and higher perfusion rates can be applied in narrow capillaries without risking tissue edema, a ceiling on plasma...
  • 9
  • 310
  • 0
Báo cáo y học:

Báo cáo y học: " Blood product ratio in acute traumatic coagulopathy - effect on mortality in a Scandinavian level 1 trauma centre" pptx

Báo cáo khoa học

... interpretation of data; SRO: has made substantial contributions to analysis and interpretation of data; PIJ has made substantial contributions to conception and design, acquisition of data, analysis and ... study was that a change in transfusion therapy with more aggressive and early administration of plasma and platelets in relation to RBC did not influence survival in the trauma patients investigated, ... data base LOS and 30 day mortality were obtained from the database of the hospital and the Page of Central Office of Civil Registration All data were collected and entered into a study database...
  • 9
  • 200
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Impacts of both reference population size and inclusion of a residual polygenic effect on the accuracy of genomic prediction" potx

Báo cáo khoa học

... national conventional evaluation for all bulls Forty-four traits from seven trait groups were analysed: milk production (three traits), udder health (one trait), functional longevity (one trait), ... The total additive genetic variance, a , was obtained from a conventional pedigree-based analysis, e.g for milk production traits [6] and for female fertility traits [7], and was partitioned into ... the p markers (1 − w) a We assumed that all markers contribute equal genetic variance The proportion of residual polygenic variance w was assumed to vary across traits The optimal w value was determined...
  • 9
  • 524
  • 0
a study on projection and its realization in president barack obama’s speech at a campaign event in las vegas

a study on projection and its realization in president barack obama’s speech at a campaign event in las vegas

Khoa học xã hội

... of a language, namely ideational metafunction, interpersonal metafunction and textual metafunction It is obvious that language can make various meanings simultaneously The meaning of a language ... and disadvantages such as traditional grammar, universal grammar and generative grammar by Noam Chomsky and his followers However, the most popular trend of grammar is functional grammar that is ... The clauses making up clause nexus are primary and secondary clauses The clauses making up clause nexus are primary and secondary clauses The primary may be the initiating clause in a paratactic...
  • 67
  • 428
  • 0
A study on projection and its realization in President Barack Obama’s speech at a campaign event in Las Vegas

A study on projection and its realization in President Barack Obama’s speech at a campaign event in Las Vegas

Tổng hợp

... Hanoi: Vietnam National University Nunan, D (1993) Discourse Analysis London: Penguin Group Richards et al (1992) Longman Dictionary of Language Teaching and Applied Linguistics London: Longman ... types of projection are realized in President Obama’s speech at a Campaign Event in Las Vegas In order to achieve this aim, an overview of the key concepts of functional grammar relevant to the study ... projections in President Barack Obama’s speech at a Campaign Event in Las Vegas Part C – Conclusion – recapitulates the results of the study In this part, the author reviews such concepts as systemic...
  • 3
  • 258
  • 1

Xem thêm