load new data on a click event

Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc

Ngày tải lên : 07/03/2014, 05:20
... TCATGGAATCAGTCCGGGAGGGAA AGGCAAGGCTGGAAGATATTTTT GAAACAGTGTCGGATAAAGCTGC ACGGGCGGCCATTTGATATGCTTG GGCCATTGTTGAAAGAGAGG TCATGCTTTATCTTTGAAGAGAGG TCTCTACGTGTATCAAAGGTAGTAAGG TGGCATTTAGAAACTTCATTCA ... Psy1R381 TaqManPsy1 Psy2F952 Psy2R1024 TaqManPsy2 PSY1For21 PSY1Rev1522 PSY2For27 PSY2Rev1674 GAAACGGCTACCACATCCAAG CCCCGTGTTAGGATTGGGT AAGGCAGCAGGCGCGCAAA TGACGTCTCAAATGGGACAAGT CCTCGATGAATCAAAAAAACGG ... O, Laferriere A, d’Harlingue A & Camara B (1988) Carotenoid biosynthesis: isolation and characterization of a bifunctional enzyme catalyzing the synthesis of phytoene Proc Natl Acad Sci USA 85,...
  • 9
  • 607
  • 0
báo cáo sinh học:" New data on African health professionals abroad" docx

báo cáo sinh học:" New data on African health professionals abroad" docx

Ngày tải lên : 18/06/2014, 17:20
... Guinea Eritrea Ethiopia Gabon Gambia Ghana Guinea Guinea-Bissau Kenya Lesotho Liberia Libya Madagascar Malawi Mali Mauritania Mauritius Morocco Mozambique Namibia Niger Nigeria Rwanda Sao Tome ... http://www.human-resources-health.com/content/6/1/1 Mozambique Guinea-Bissau Angola Liberia Equatorial Guinea São Tome & P Malawi Zambia Ghana Gambia Congo, Rep Tanzania Senegal Zimbabwe Cape Verde Kenya Mauritius Cameroon Namibia ... Central Afr Rep Guinea-Bissau Zimbabwe Ghana Comoros Togo Cameroon Mozambique Ethiopia Malawi Mali Morocco Rwanda Benin Angola Congo, Dem Congo, Rep Nigeria Chad Uganda Somalia Zambia Algeria Kenya...
  • 11
  • 379
  • 0
Word Grammar New Perspectives on a Theory of Language Structure. docx

Word Grammar New Perspectives on a Theory of Language Structure. docx

Ngày tải lên : 27/06/2014, 16:20
... dependency-based approach within WG, the Constructional HPSG approach, and the Linearization HPSG analysis Maekawa, a HPSG linguist, argues that the approaches within WG and the Constructional HPSG have ... heart, and networks also loomed large at tihat time in the Stratificational Grammar of Lamb (1966; Bennett 1994) Another reason why stratificational grammar was important was that it aimed to be a ... of head and claims that every phrase has both a distributional head and a structural head, although he agrees that normally the same word is both distributional and structural head of a phrase...
  • 251
  • 554
  • 0
3.Storing Data on a Disk.ppt

3.Storing Data on a Disk.ppt

Ngày tải lên : 16/07/2014, 01:00
... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ ... ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ Page Sheet1 ÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿÿ...
  • 30
  • 215
  • 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Ngày tải lên : 23/11/2012, 15:04
... the 22nd international conference on Machine learning [10] Eric Chu, Akanksha Baid, Ting Chen, An-Hai Doan, and Jeffrey F Naughton A relational approach to incrementally extracting and querying ... un-structured data In VLDB 2007 [11] Ian H Witten and Eibe Frank Data Mining: Practical machine learning tools and techniques Morgan Kaufmann, San Francisco, 2005 [12] Jun Xu and Hang Li Adarank: a boosting ... chapter: Generative and Discriminative classifiers McGraw-Hill, New York www.cs.cmu.edu/tom/newchapters.html [22] T S Jayram, Rajasekar Krishna-murthy, Sriram Raghavan, Shivakumar Vaithyanathan,...
  • 51
  • 393
  • 0
Tài liệu Mary Kay puts a New Face on Wireless pptx

Tài liệu Mary Kay puts a New Face on Wireless pptx

Ngày tải lên : 10/12/2013, 19:15
... and 1900MHz voice and EDGE data services for Cingular In all, it took only ten days to install the cabling, RAUs and antennas IDEX, the contractor that installed the cabling, was a trusted contractor ... is transparent Cingular manages the Unison system from its own operations center, and thanks to Unison’s active architecture and extensive operations and maintenance capabilities, the carrier ... problem, Mary Kay looked at several cellular carriers for its primary coverage contract Naturally, better coverage was a top requirement on the list Eventually, AT&T Wireless (now Cingular) offered...
  • 3
  • 379
  • 0
Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

Tài liệu DSXi™ Panels and Bays Connecting on a Whole New Level doc

Ngày tải lên : 21/12/2013, 07:15
... traditional DSX panels to improve density, manageability, and delivery Take a look at DSXi from ADC It’s connecting on a whole new level increased density Connect with DSXi panels and bays, and you ... you can save valuable floor space By configuring a low-profile 84-circuit DSXi panel measuring only four inches high, you can increase your bay capacity from 11 standard panels to 14—for a total ... Much like the main cog in a complex set of gears, DSX (Digital Signal Cross-connect) panels are an integral part of operating and maintaining communications networks As technology continues to become...
  • 6
  • 378
  • 0
Tài liệu Put the Finishing touches On A Data Bound Form pdf

Tài liệu Put the Finishing touches On A Data Bound Form pdf

Ngày tải lên : 26/01/2014, 11:20
... The tasks displayed in this How-To are just a few of the tasks you can to make your forms look and feel more professional They are also what users come to expect from database applications Play ... added are shown here: '- Enable/Disable the appropriate buttons btnEdit.Enabled = Not bEnable btnNew.Enabled = Not bEnable btnDelete.Enabled = Not bEnable btnCancel.Enabled = bEnable btnSave.Enabled ... form allows users to access command buttons only when the functionality is available Steps Continuing on with the form that you have been using, you are going to make the changes just mentioned...
  • 6
  • 304
  • 0
Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt

Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt

Ngày tải lên : 16/02/2014, 03:20
... resource management both on a national and on a global scale National Australia Bank believes that natural resource and environmental risks should always be considered as part of a balanced approach ... Systematise analysis of environmental degradation, separate carbon from Footprint of production, incorporate additional measures of degradation Increase sophistication of analysis regarding carbon ... agricultural raw materials UNCTAD data Exposure to degradation Change in the country’s trade balance as a result of a 10 per cent fall in production of renewable natural resources Expressed as a share...
  • 40
  • 397
  • 0
Báo cáo " A NEW VIEW ON AN OLD PROBLEM IN QUANTUM CHROMODYNAMICS " potx

Báo cáo " A NEW VIEW ON AN OLD PROBLEM IN QUANTUM CHROMODYNAMICS " potx

Ngày tải lên : 05/03/2014, 14:20
... infrared nonperturbative interaction We suggested the new infrared mechanism of dimensional transmutation that is omitted in the conventional approach and leads effectively to the stochastization ... CAC and hadron mass spectra At this stage the ideology of potential confinement arise Its essence consists in the aspiration to got confinement gluon propagator (or quark-quark potential) by an ... transmutation parameter - the analog of the arrangement energy resolution in QED (Recall that the old renormalization group QCD parameter Λ was also defined by a nonperturbative interaction in the infrared...
  • 7
  • 349
  • 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc

The 1998 bleaching event and its aftermath on a coral reef in Belize doc

Ngày tải lên : 07/03/2014, 17:20
... shelf lagoon, as well as on the outer barrier reef and in the lagoon at Glovers Reef, an atoll-like carbonate platform seaward of the barrier reef (McClanahan and Muthiga 1998; Aronson and Precht ... (Day+Night) Pathfinder values for the Channel Cay area increased the number of available SST measurements by a factor of two over Night data alone Day+ Night data also gave us a more valid basis ... the manuscript, as did the comments of an anonymous reviewer M .A. Toscano acknowledges the assistance of R.P Stumpf (NOAA/National Ocean Service) and K.S Casey (NOAA/National Oceanographic Data Center)...
  • 13
  • 583
  • 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf

Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf

Ngày tải lên : 09/03/2014, 01:20
... not approI)riate for inclusion in an upper model, e.g., textual organisation infor- - 288 - mation, non-hierarchical conceptual information and speech act information Penman has a rich variety ... [3] Bateman, John A and Christian M.I.M Matthiessen "Using a functional gramamr as a tool for developing planning algorithms - an illustration drawn from nominal group planning" USC/Information ... multi-level transfer is an SPL representation of the English translation of the original German sentence, which may then drive generation by Penman as in any other application domain The translation process...
  • 9
  • 680
  • 1
Đề tài " Higher composition laws I: A new view on Gauss composition, and quadratic generalizations " docx

Đề tài " Higher composition laws I: A new view on Gauss composition, and quadratic generalizations " docx

Ngày tải lên : 14/03/2014, 22:20
... 2a0 a2 + a0 a1 a3 − ε a1 ), − (a1 a2 − 2a2 a3 + a0 a2 a3 + ε a2 ), 2 − 3a a a + a a2 + ε a ), − ( 2a2 3 c0 = c1 = c2 = c3 = where as usual ε = or in accordance with whether D ≡ or modulo (Again, ... with each other; this is analogous to the fact that row and column operations on a rectangular matrix commute Hence we obtain a natural action of Γ on C2 Now given any cube A ∈ C2 as above, ... Annals of Mathematics, 159 (2004), 217–250 Higher composition laws I: A new view on Gauss composition, and quadratic generalizations By Manjul Bhargava Introduction Two centuries ago, in...
  • 35
  • 430
  • 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Ngày tải lên : 23/03/2014, 17:22
... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... Fuc and 3-substituted Rha in the molar ratio  : These data suggest that the OPS-I and OPS-II have an identical branched tetrasaccharide repeating unit It consists of the main chain containing one ... group at d 2.19 These data were in agreement with a tetrasaccharide repeating unit containing three residues of 6-deoxy sugars, one residue of ara4dHex and one O-acetyl group In addition to the major...
  • 7
  • 478
  • 0
Math Concept Reader MCR g4 a new angle on trains and train stations

Math Concept Reader MCR g4 a new angle on trains and train stations

Ngày tải lên : 24/05/2014, 07:40
... DIGITAL FINAL PROOF ca62xs_lay_061207ad_am.indd 1/9/07 9:09:15 AM DIGITAL FINAL PROOF Math Concept Reader A New Angle on Trains and Train Stations by Sarah Mastrianni Copyright © Gareth Stevens, ... information is called a schedule, and schedules are available on paper, on the Internet, and on monitors and boards at the stations Train tracks run north, south, east, west, and all directions ... that plane figures are everywhere It might occur to you that many train stations around the country are called Union Station A union station is a very large railway station with many tracks and...
  • 19
  • 433
  • 0
báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot

báo cáo hóa học: " Reliability and validity of a new scale on internal coherence (ICS) of cancer patients" pot

Ngày tải lên : 18/06/2014, 18:20
... carcinoma Ovarian sarcoma Pancreatic cancer Pharyngeal cancer Plasmocytoma Pleural mesotelioma Prostatic cancer Rectum carcinoma Thymic carcinoma Thyroid carcinoma Tonsillar carcinoma Urethral cancer ... Lymphoma (NHL) Breast cancer Bronchial carcinoma (NSCLC) Carcinoma unclear primary (CUP) Cervix carcinoma Colon carcinoma Gallbladder carcinoma Hypernephroma Leiomyosarcoma Melanoma Ovarian carcinoma ... all participants, we performed an orthogonal principal components analysis (rotation: varimax with Kaiser normalisation) We used the self-regulation questionnaire as a main convergence criterion...
  • 11
  • 622
  • 0
Báo cáo hóa học: " A new construction on the q-Bernoulli polynomials" pptx

Báo cáo hóa học: " A new construction on the q-Bernoulli polynomials" pptx

Ngày tải lên : 20/06/2014, 22:20
... France Authors’ contributions Coresponding author raised the problem and make a sequence to appoach the problem AB carried out the qBernoulli poynomials studies, participated in the making new ... 2010 Author details Department of Mathematics Education, Kyungpook National University Daegu 702-701, South Korea 2Département de mathématiques, Université Evry Val d’Essonne, Bd F1 Mitterrand, ... et al.: A new construction on the q-Bernoulli polynomials Advances in Difference Equations 2011 2011:34 Submit your manuscript to a journal and benefit from: Convenient online submission Rigorous...
  • 6
  • 331
  • 0
Báo cáo hóa học: " A new construction on the q-Bernoulli polynomials" docx

Báo cáo hóa học: " A new construction on the q-Bernoulli polynomials" docx

Ngày tải lên : 21/06/2014, 00:20
... France Authors’ contributions Coresponding author raised the problem and make a sequence to appoach the problem AB carried out the qBernoulli poynomials studies, participated in the making new ... 2010 Author details Department of Mathematics Education, Kyungpook National University Daegu 702-701, South Korea 2Département de mathématiques, Université Evry Val d’Essonne, Bd F1 Mitterrand, ... et al.: A new construction on the q-Bernoulli polynomials Advances in Difference Equations 2011 2011:34 Submit your manuscript to a journal and benefit from: Convenient online submission Rigorous...
  • 6
  • 301
  • 0
Báo cáo hóa học: " Research Article On a New Hilbert-Type Intergral Inequality with the Intergral in Whole Plane" pdf

Báo cáo hóa học: " Research Article On a New Hilbert-Type Intergral Inequality with the Intergral in Whole Plane" pdf

Ngày tải lên : 21/06/2014, 07:20
... Journal of Inequalities and Applications Both of them are important in Mathematical Analysis and its applications It attracts some attention in recent years Actually, inequalities 1.1 and 1.2 have ... and Z Zeng, A Hilbert-type integral inequality with a non-homogeneous form and a best constant factor,” Advances and Applications in Mathematical Science, vol 3, no 1, pp 61–71, 2010 Z Xie and ... Kluwer Academic, Boston, Mass, USA, 1991 Z Xie and Z Zeng, A Hilbert-type integral inequality whose kernel is a homogeneous form of degree −3,” Journal of Mathematical Analysis and Applications,...
  • 8
  • 319
  • 0
Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx

Báo cáo hóa học: " Research Article On a New Hilbert-Hardy-Type Integral Operator and Applications" pptx

Ngày tải lên : 21/06/2014, 07:20
... Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 B G Pachpatte, On some new inequalities similar to Hilbert’s inequality,” Journal of Mathematical Analysis and Applications, ... some particular examples are considered Journal of Inequalities and Applications A Lemma and Two Equivalent Inequalities Lemma 2.1 If λ < 2, kλ x, y is a nonnegative homogeneous function of ... defined, and the norm of operator is obtained As applications, a new Hilbert-Hardy-type inequality similar to 1.3 is given, and two equivalent inequalities with a best constant factor as well as some...
  • 10
  • 333
  • 0