coaching is a special kind of conversation not a special event on the corporate calendar
Deal Coaching is a Lost Art Smashwords Edition Author: Peter Bourke pot
... a sales organization that makes deal coaching a painful indictment of the sales person or team and I’ll show you an organization that doesn’t deal coaching well (or often) In fact, evidence of ... derelict at worst! Isn’t this what sales managers are paid to do? Is there a better use of their available time? Is deal strategy that difficult to implement and sustain? Answering these questions and ... familiar? It happens every day in most sales organizations! Stealing the deal – this is the “superman” sales managers who hears about trouble in an opportunity that is critical to make this month’s...
- 15
- 240
- 0
Báo cáo Y học: Arginine 121 is a crucial residue for the specific cytotoxic activity of the ribotoxin a-sarcin potx
... behaviour of a- sarcin against ApA as a function of pH, altogether with the characterization of the individual pKa values of the active site residues, were consistent with the existence of two mechanisms ... [20] A quantitative analysis of the ribonuclease activity of a- sarcin has been developed by using the dinucleotide ApA as substrate [18] Both mutant variants hydrolysed ApA They displayed a Km value ... variant, while mutation of either Glu96 or His137, residues acting as the general acid and base on the catalysis by a- sarcin [19,20], rendered proteins with no detectable activity against ApA...
- 7
- 434
- 0
Báo cáo y học: " The switch from conventional to atypical antipsychotic treatment should not be based exclusively on the presence of cognitive deficits. A pilot study in individuals with schizophrenia" pps
... studies have demonstrated that both conventional and atypical APDs increase neurogenesis and proliferation of nonneuronal cells in the adult brain, particularly in some areas of the hippocampus ... that did not offer psychosocial rehabilitation programs At each time point, all patients were medicated by their psychiatrists in a naturalistic manner The average daily dose of APD was converted ... cognitive and clinical scores were analyzed using an analysis of variance (ANOVA) with repeated measures Cognitive performance at T1 and T2 were the dependent variables and the type of APD was the...
- 10
- 412
- 0
Báo cáo y học: " Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary" potx
... neurochemical events involved in the neuronal release of DA The cascade of these neuronal events has been termed "Brain Reward Cascade" A breakdown of this cascade will ultimately lead to a dysregulation ... tegmental area (VTA) allows them to release dopamine in the NAc and (via amygdala) in certain parts of the hippocampus, permitting the completion of the cascade and the development of the reward ... naturally required DA release at the NAc Gabapentin is a gamma-aminobutyric acid (GABA) analogue, with GABAmimetic pharmacological properties Gabapentin is used for the treatment of seizures, anxiety...
- 16
- 405
- 0
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... serves as a tissue for haematopoiesis during gestation, the vascular development in liver is essential Angioblasts, precursors of endothelial cells, start to appear near the hepatoblasts at the stage ... proliferation and migration of hepatoblasts (Matsumoto et al., 2001) The formation of liver bud is also related to other transcription factors, such as Hex and Prox1 The studies of hex mutants have ... regulation through the function of two distinct tissues: the exocrine pancreas and endocrine pancreas The exocrine pancreas has two components: acinar cells and ductal epithelial Acinar cells can...
- 199
- 296
- 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell
... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... performance but also in eventual rupture of the membrane Thermal management is also essential for the control of the water evaporation or condensation rates [1-3] The need for improved lifetime of air-breathing ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the...
- 16
- 727
- 0
A discourse analysis of advertisements in english and vietnamese on the internet
... business? The long Island Association The long Island Association Advocacy Networking Benefits LIA Long Island Association Leading long island Learn more In (52) “LIA” was illustrated by The long Island ... CHAPTER of music, language, and pictures For this reason, I wish to carry out INTRODUCTION my research on the topic A Discourse Analysis of Advertisements in 1.1 RATIONALE Language is used as ... English and Vietnamese are analyzed in the perspective of Semiotics - The focus of this thesis is put on the application of Experts 877.458.3838 Learn more communication functions of Jakobson, the...
- 15
- 2,309
- 3
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc
... evaluation settings Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... mirrors the myriads of interactions taking place in a company and the value created in each of them The problem is not the amount of relationships since firms have the help of sophisticated information ... information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy...
- 15
- 796
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... 1991–1992: Dissemination of the ideas for change A distribution of the ideas contained in the firm’s mission and values was carried out, with the participation of all workers This mainly involved the attempt ... knowledge and of innovations implies the application of intelligence, tacit knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not ... important achievements reached in relation with KM as an innovation strategy at Irizar are the following: * Overall personnel satisfaction Measured by a satisfaction at work questionnaire, which has...
- 10
- 1,063
- 1
Tài liệu A Historical Primer on the Business of Credit Ratings docx
... Americans went on within a century to succeed the English as the world’s pre-eminent national economy Larry Neal, The Rise of Financial Capitalism: International Capital Markets in the Age of Reason ... tolerably consistent set of data allowing one to compare historical bond market developments across countries His data appear to indicate that as early as 1850 the U.S corporate bond market was as ... debt of U.S railroad corporations The corporate bond market, essentially a railroad bond market in its early decades, can properly be viewed as an American financial innovation that later spread...
- 30
- 611
- 1
Tài liệu Báo cáo khoa học: Cell surface nucleolin on developing muscle is a potential ligand for the axonal receptor protein tyrosine phosphatase-r ppt
... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... degradation of nucleolin, mean that calculations of binding affinity are unrealistic at this stage Nucleolin localization in muscle is analogous to PTPr ligand localization To determine whether the ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual...
- 14
- 669
- 0
Tài liệu Overview on Poultry Sector and HPAI Situation for Indonesia with Special Emphasis on the Island of Java - Background Paper doc
... hectares), and Malaysia (7.9 million hectares) The national capital of Indonesia is Jakarta, a metropolitan area with a population of over million; Greater Metropolitan Jakarta includes the suburban ... Emas; Tenau; Syamsudin Noor; Sepinggan; Tarakan; Malahayati (Aceh); Tanjung Balai Asahan; Entikong; Ternate; Ambon; and Timika Regulation (Legislation and enforcement) o Strengthen the legislative ... reflect the welfare status of the population in the city In fact, many people live in slum urban areas in the city of Jakarta, Surabaya, Medan, Bandung and Makassar Africa/Indonesia Team Working Paper...
- 77
- 949
- 0
Report of the Special Rapporteur on the promotion and protection of the right to freedom of opinion and expression, Frank La Rue* ppt
... privacy and protection of personal data, which inhibit the dissemination of opinions and information The Special Rapporteur is of the view that the arbitrary use of criminal law to sanction legitimate ... intermediaries to undertake censorship on its behalf, as is the case in the Republic of Korea with the establishment of the Korea Communications Standards Commission, a quasi-State and quasi-private ... Representative of the Secretary-General on the issue of human rights and transnational corporations and other business enterprises The framework rests on three pillars: (a) the duty of the State to...
- 22
- 400
- 0
Diary of a Nursing Sister on the Western Front, 1914-1915 pptx
... that it has all been done on purpose, and that none of them are accidents or surgical diseases And they seem all to take it as a matter of course; the bad ones who are conscious don't speak, and ... to-night that Miss , the Principal Matron on the Lines of Communication (on the War Establishment Staff) is here again, and may have a new destination for some of us details The heading in 'Le Matin' ... saloon (where I can take a long walk) after a long wait, with café au lait and an omelette at Juvisy, and 'The Times' of October 5th There is a pleasing uncertainty about one's own share on Active...
- 98
- 617
- 0
A Modern Treatise on the Principle of Legality in Criminal Law doc
... that the only legitimate standard for accepting a mistake of law defense is the standard of a strict liability mistake.90 This standard significantly reduces the probability that a mistake of law ... 2.1.2 Criminal Sanction The result of a valid conditional clause is a criminal sanction, which is an integral part of the criminal norm There is no doubt about the centrality of the sanction within ... structure of the criminal norm contains only valid conditional clauses A valid conditional clause that is part of the criminal norm contains the components necessary to impose criminal liability on the...
- 214
- 2,149
- 0
Báo cáo khoa học: "A NEW VIEW ON THE PROCESS OF TRANSLATION" pdf
... which is thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the ... being the UMG is almost isomorphic to a representation of the predicate-argument part of the German IS grammar is more due to time constraints than to any far reaching claims about the mutual relationships ... drive generation by Penman as in any other application domain The translation process as a whole is summarised in Figure The general strategy of this translation process should also generalise to...
- 9
- 680
- 1
Báo cáo khoa học: What’s in a covalent bond? On the role and formation of covalently bound flavin cofactors doc
... Plant VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO VAO GMC GMC GMC Succinate dehydrogenase Succinate dehydrogenase DAAO DAAO DAAO DAAO ? ? VAO AMO AMO DAAO DAAO ... Plant Plant Bacteria Plant Plant Fungus Bacteria Bacteria Bacteria Plant Bacteria Animal Fungus Yeast Yeast Bacteria Bacteria Plant Bacteria Fungus Fungus All Bacteria Animal Animal Bacteria Bacteria ... Bacteria Bacteria Fungus Bacteria Animal Animal Fungus Bacteria Animal Bacteria Plant Bacteria Bacteria Plant allergens BG6 0a [55] and Phl P 4a [165] Tetrahydrofuran monooxygenase reductase component...
- 23
- 564
- 0
Báo cáo khoa học: The effects of a-secretase ADAM10 on the proteolysis of neuregulin-1 pot
... GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT ... NRG -a_ rev NRG-5¢_for NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG ... at a ¨ concentration of lm GM6001 (Calbiochem, San Diego, CA, USA) was used at a final concentration of 10 lm and phorbol 12-myristate 13-acetate (Sigma, Deisenhofen, Germany) was used at a concentration...
- 13
- 487
- 0
Báo cáo khoa học: Transcriptional regulation of the desferrioxamine gene cluster of Streptomyces coelicolor is mediated by binding of DmdR1 to an iron box in the promoter of the desA gene doc
... GCGGCGACGGCGACGGCAAGAG CGGGGGAGCGGGCGATGACCT GCAGATGCGCGTGCCAGACC CGGCGCCAGTAGCCGACGAAG CGGGTGGCCGCCAAACTCG AGGAAGCGCGGTCAAGGGAGTCTC CGCAAGGCGCTGGCCGAGTTCA TGTGCAGCAGCGGGACGTAGTAGG GGAATTCCGCGCGCGGGTCTGGCTTCA ... iron limitation, as shown by the RT-PCR analysis, and there is overlapping of the desB translation termination triplet with the ATG of desC and also of desC and desD (so-called translational coupling); ... Table 2) allowed clear identification of the desA transcription start point at a thymine located 62 nucleotides upstream of the ATG translation initiation codon of desA This transcription start...
- 13
- 456
- 0
Báo cáo Y học: The Fe-only nitrogenase and the Mo nitrogenase from Rhodobacter capsulatus A comparative study on the redox properties of the metal clusters present in the dinitrogenase components doc
... of activity upon oxidation) These results provide conclusive evidence that the g ¼ 2.27 signal is not an artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped ... may arise from Heisenberg broadening as a consequence of an unusually short relaxation time Another possible cause for the signal broadness may be due to the transition of one (or more) of the ... that: (a) the FeFe cofactor is diamagnetic in the Na2S2O4reduced state containing 4FeII and 4FeIII centers, and (b) the main structural feature of the FeMoco, the central trigonal prismatic arrangement...
- 12
- 748
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25