a useful tool for the genetic improvement of the cultivated peanut arachis hypogaea l
báo cáo khoa học: " Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea)" doc
... TTACACGGTAGCCCATTTCC TCGGAGAACAAGCACACATC CAGAGTCTGTGATTTGTGCACTG AAATAATGGCATACTTGTGAACAATC CCCTCGAAGGTGGAATTCAT TGCATGTCTCTTGTAACTTAATACACT CTTGGAGTGGAGGGATGAAA GAAGGTGGAATTCATTCTCAAAA GAAAATGATGCCATAAAGCGTA ... pietrarellii Arachis prostrata Arachis macedoi Arachis villosulicarpa Arachis subcoriacea Arachis burkartii Arachis glabrata Arachis pseudovillosa Arachis guaranitica Arachis triseminata Abbreviations: As ... Arachis stenosperma Arachis subdigitata Arachis valida Arachis villosa Arachis pintoi Arachis repens Arachis paraguariensis Arachis hermannii Arachis major Arachis burchellii Arachis pietrarellii...
- 13
- 260
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... version and an HTML help file version, and will soon be available in French and Italian, as well as English While the focus of NorthStar is on QI programmes at a national or regional level, those ... Paris Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto Grilli ... NorthStar is an integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national...
- 7
- 429
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... such oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in ... the systems are so large that a detailed molecular analysis is beyond reach and modularization is required Because we here analyze at the level of complete molecular detail (i.e only reactions with ... that are formulated down to the detail of simple unimolecular and bimolecular reactions can be organized into topologies The latter can then be examined for their potential to induce oscillations...
- 11
- 638
- 0
A visualization tool for the rapid analysis of bacterial transcriptome data pot
... than is currently publicly available We therefore developed Genome2D, a software tool that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at ... lactis IL1403 (color file) (Additional data file 3); a table of cre-boxes identified in promoters of genes in the L lactis IL1403 genome (Additional data file 4) All additional data files can also ... program menu structure Regular updates of Genome2D will be available via the Internet [43] Because of the exponential increase of publicly available bacterial genome sequences and large-scale reviews...
- 6
- 510
- 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc
... of the KEGG atlas is a graphical visualization of compounds in the context of the global metabolic reaction network The KEGG atlas, however, does not provide quantitative and statistical analyses ... propose an analytical framework for the interpretation of molecular mechanisms that unite a list of compounds This analytical framework is implemented as the freely accessible web tool TICL As we ... visualization capabilities The user can also download a preformatted text file and use the medusa package [34] to visualize the inferred model on a computer Figure illustrates a typical visualization...
- 11
- 401
- 0
báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt
... often lead to the loss of functional competence of the spermatozoa The major advantage of AFM in pathological studies of spermatozoa is that it allows the evaluation of position and form of the acrosome ... Katayama E, Yanagida T: Dynein arms are oscillating force generators Nature 1998, 393:711-714 Sakakibara H, Kojima H, Sakai Y, Katayama E, Oiwa K: Inner-arm dynein c of Chlamydomonas flagella ... flagella adhere onto glass substrates [23] They further reported that Mg-ATP significantly increases the high frequency oscillations of the flagellum Both, a horizontal as well as a vertical component...
- 6
- 363
- 0
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can ... simulated annealing, and genetic algorithms and found that a genetic algorithm approach consistently outperformed the others In the genetic algorithm approach, we begin with an initial set of random ... structure and algorithm called Jungles that solves the cophylogeny reconstruction problem optimally [5] The Jungles approach discards all solutions with strong incompatibilities and optimally resolves...
- 10
- 551
- 0
Báo cáo khoa học: " Is bronchoalveolar lavage with quantitative cultures a useful tool for diagnosing ventilator-associated pneumonia" doc
... Critical Care Vol 11 No Fagon et al Table Outcomes and antibiotics in the Canadian Critical Care Trials Group study [1] Endotracheal aspiration (n = 374) Bronchoalveolar lavage (n = 365) ... a result below the usual threshold of 104 colony-forming units/ml could indicate either that the patient has been successfully treated for pneumonia and the bacteria are eradicated, or that there ... meropenem alone Several studies have clearly established that initial antimicrobial therapy in patients with VAP should be customized to local epidemiology at the ICU level [11] Fourth, even on day the...
- 3
- 213
- 0
báo cáo khoa học: " Utility of EST-derived SSR in cultivated peanut (Arachis hypogaea L.) and Arachis wild species" potx
... AG/CT AT/AT AAC/GTT AAG/CTT AAT/ATT ACC/GGT ACG/CTG ACT/ATG AGC/CGT AGG/CCT AGT/ATC CCG/CGG AAAG/CTTT AAAT/ATTT AATC/AGTT AATT/AATT ACAT/ATGT AAAAG/CTTTT AAAAT/ATTTT AGTAT/ATATC AAAAAG/CTTTTT AAGACG/CTGCTT ... 288 AC/GT AG/CT AT/AT Tri 55 14 218 56 563 AAC/GTT AAG/CTT AAT/ATT ACC/GGT ACG/CTG ACT/ATG AGC/CGT AGG/CCT AGT/ATC CCG/CGG 15 AAAG/CTTT AAAT/ATTT AATC/AGTT AATT/AATT ACAT/ATGT Penta-type AAAAG/CTTTT ... AA, Barbosa AV, Palmieri DA, Lopes CR: Characterization and transferability of microsatellite markers of the cultivated peanut (Arachis hypogaea L. ) BMC Plant Biol 2007, 7:9 He G, Meng RH, Gao...
- 9
- 192
- 0
Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf
... transcription bleef bleven ~ron R pronunc t at t o n s I~"~Ix I'bLe~ftl I'bLeH'tl I'bLe~v~nl I'bLe~v~ntl I'bLefl I'bLevanl Iga'bLevanl Using the same information, we can easily develop an alternative filter ... stressed syllable and the following weak syllables if any For example, the rhyme determining part of w~rrelea (to whirl) is er-ve-len, of versn6llea (to accelerate) el-lea, and of 6verwdrk (overwork) ... architecture can be applied advantageously in lexicography RELATRD ~ C H The presence of both static information (morpheancs and features) and dynamic information (morphological rules) in LKBs is also advocated...
- 5
- 467
- 0
Báo cáo y học: "The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors" pdf
... will be used when available Utility and Discussion Searching the database and displaying information: Basic Search Page The home page of the database is also the Basic Search page (Figure 3A) ... Gronostajski et al.: The NFI-Regulome Database: A tool for annotation and analysis of control regions of genes regulated by Nuclear Factor I transcription factors Journal of Clinical Bioinformatics ... to the limitation of MyISAM not having transaction management or foreign key management The overall structure of the tables (Figure 1) was developed specifically for this database The tables can...
- 10
- 386
- 0
báo cáo khoa học: "Use of RE-AIM to develop a multi-media facilitation tool for the patient-centered medical home" potx
... plan module stores patient action plans and provides ongoing access to the plans by the healthcare team and the patient for self-monitoring and follow-up Alternatively, the healthcare team may ... ensure that appropriate audio and visual aids are in place to assist all patients, particularly low literacy, minority, less acculturated, older, poorer, or less educated patients who may feel overwhelmed ... M, Fernald DH, Green LA Practical and relevant self-report measures of patient health behaviors for primary care research Annals of Family Medicine 2005;3:73-81 (47) Paxton A, Strycker LA, Toobert...
- 31
- 351
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... and the interpretation of the results, helped draft the manuscript, and read and approved the final manuscript Additional material Additional file Development and evaluation of a tool for the assessment ... objective tools available for use clinically or for research purposes Tools which have been previously published [17-20] have lacked evaluation of their reliability, or their applicability has been limited ... as the average of the height medially and laterally from the base of the heel to the centre of the heel-sole interface Forefoot height (measured at point of first and fifth metatarsophalangeal...
- 12
- 379
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... surface of the pollinated stigma At higher magnification (inset), most of the labelling can be observed as attached to the papillae cells in the form of a thick layer Yellowish autofluorescence of ... precipitates are localized on the outer surface of the papilla cell walls (arrowheads) (C) Stigmatic papillae of a completely open flower with turgid anthers (stage 3): thick layer of exudate that has plentiful ... Olmedilla A: Programmed-cell-death hallmarks in incompatible pollen and papillar stigma cells of Olea europaea L under free pollination Plant Cell Rep 2010, 29:561-72 41 Brewbaker JL, Kwack BH: The...
- 12
- 529
- 0
Báo cáo y học: " Pruritus: a useful sign for predicting the haemodynamic changes that occur following administration of vancomycin" ppsx
... Apart from collection of haemodynamic data, at each time point two blood samples were drawn (one from the radial artery cannula and another from the distal port of the pulmonary artery catheter) in ... measure arterial and mixed venous blood parameters that are necessary for calculation of Qsp/Qt (i.e haemoglobin concentration, and oxygen tension and saturation) Analysis of the blood samples ... Group A Calcium channel blocker The pulmonary shunt fraction (Qsp/Qt) was calculated using the following equation [12]: Parameter Trinitroglycerin Each haemodynamic profile consisted of parameters...
- 6
- 260
- 0
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt
... measure their prevalence and risk factors, there is a clear need for more culturally adapted and validated scales for use among youth The AYMH scale fills an important gap and addresses some of ... check the equality of variance assumption Internal consistency of the scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by the ... region The validation revealed that the AYMH scale has reasonably good construct validity and internal consistency However, the scale has moderate discriminatory capabilities as a diagnostic tool for...
- 7
- 386
- 0
Báo cáo y học: "The Utstein template for uniform reporting of data following major trauma: A valuable tool for establishing a pan-European dataset" docx
... all will be a very valuable tool It will be interesting to see whether this smaller dataset will allow more complete data collection on larger numbers of patients, and whether valuable analyses ... combination of such databases, the management of missing data and the sensible exploration of large-scale data For now, both approaches are valid A robust, clearly defined core dataset common to all ... product administration can all be tagged electronically, as can the patient's position within the hospital Other databases, such as ICU, pathology and radiology systems already collect much of the...
- 2
- 246
- 0
Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx
... greatly facilitates the automatic validation of annotation data, as the relationships implied by an annotation can be compared to the allowable relationships specified in the ontology For example, ... CG14478-RA CG14478-RB These data afford many potential analyses, but as our motivation was primarily to demonstrate the practical utility of SO as a tool for data management, rather than comparative ... potential of these operations to classify alternative transcripts and their exons below Results and discussion As part of a pilot project to evaluate the practical utility of SO as a tool for data...
- 12
- 299
- 0
- human resources scanning a tool for the implementation of sustainable development
- a useful tool in the determination of the electrophilic character of benzofuroxans case examples of the reactions of nitrobenzofuroxans with dienes and nucleophiles
- cpc as a new tool for preparative scale purification of lipid and related compounds
- a tool for the assessment of risk
- a new tool for the forensic investigator
- microarray based comparative genomic hybridization array cgh as a useful tool for identifying genes involved in gl
- a useful tool for the detection of biofilm formation an important virulence fact
- hpae pad a powerful tool for the analysis of dietary fiber and complex carbohydrates
- a new tool for the stereochemical characterization of chiral molecules
- complexity quantitative traits and plant breeding a role for simulation modelling in the genetic improvement of crops
- therapy evaluation a useful tool for practitioners
- a reliable tool for the analysis of cellular processes
- a promising tool for the development of electrochemical cells
- a useful tool for shallow subsurface stratigraphy characterization
- a web tool for the detection of splice modulating exonic variants
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25