hpae pad a powerful tool for the analysis of dietary fiber and complex carbohydrates
Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx
... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... with a standard deviation of 0.35 and a mean of (black bars) The upper and lower bounds of the black dashed line represent extreme values for 10,000 simulated Gaussian distributions with the above ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate of the number of actual raw data measurements that underlie each peak Properties of ChIP-chip...
- 8
- 334
- 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the rising prevalence ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... attractiveness, availability, accessibility and affordability of fruits and vegetables? – On which areas related to nutrition, physical activity, the development of tools for the analysis of related disorders,...
- 22
- 703
- 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx
... Influencing the Selection of Education, Marketing, and Law There are many other variables that can influence managers in their selection of education, marketing, and/ or law as classes of strategic tools ... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... education and the force of law Within this framework, the manager can consider variables relevant to the selection of education, marketing, and law as sets of tools that can be brought to bear on the...
- 14
- 780
- 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... and coordination All the authors read and approved the final manuscript References Regulation (EC) No 1394/2007 of the European Parliament and of the Council of 13 November 2007 on advanced therapy ... purposed the assessment of the migration capacity of the cells At the moment there is no consensus in establishing acceptance criteria for the migration capacity of BM-MNC in cardiac regeneration ... with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone-marrow mononucleated cells used in cardiac regeneration Materials and methods...
- 9
- 773
- 0
A visualization tool for the rapid analysis of bacterial transcriptome data pot
... that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at the same time highlights additional features, such as putative regulatory sequences and ... terminators The combination of information extraction and visualization facilitates rapid, easy and intuitive analysis of genomics data, and in our research group Genome2D proved to be of great assistance ... as dataextraction and conversion algorithms, which are summarized in Table The combination of visualization and information extraction allows subsequent rounds of analyses, and thus an increase...
- 6
- 510
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... exudates (arrowheads) (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae cells and ... external biotic and abiotic factors Furthermore, at this stage, the main task of the flower bud is to complete the growth and maturation of anthers and the pistil Consequently, the intensity of the...
- 12
- 529
- 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc
... significantly different cold-acclimation capacities, we prove that mathematical modelling of metabolism and validation by experimental data offers an attractive possibility for the study of complex ... slightly lower mean rates of carbon uptake before and during the first day of cold acclimation After days of cold exposure, the mean rate of carbon uptake was significantly lower for C24 than for Rsch ... 6-phosphate; 30% KOH was added to the control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, and the samples were incubated...
- 13
- 707
- 0
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can ... ones that may and ones that cannot exhibit oscillations may be useful for the analysis of the existing models that are responsible for the oscillations Such an analysis may help to understand the ... state, oscillations can be obtained Analysis of negative and positive subgraphs and comparison of their values gives rise to the estimation of the kinetic parameters that enable such oscillations...
- 11
- 638
- 0
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc
... of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages 65–72, Columbia, Maryland, USA Ariadna Font Llitj´ s and ... searching among annotations B LAST can handle two types of annotations: error annotations and support annotations Error annotations are based on a hierarchical error typology, and are used to annotate ... postprocessing of statistical machine translation In Proceedings of LREC, pages 2175–2181, Valetta, Malta David Vilar, Jia Xu, Luis Fernando D’Haro, and Hermann Ney 2006 Error analysis of machine translation...
- 6
- 479
- 0
Báo cáo Y học: Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities pptx
... Val334, and Val336 on M4 and Ala726 and Asp730 on M6 Alanine-scanning mutagenesis along segment M4 of yeast H+-ATPase showed that replacement of Ile331 and Val334 had little or no effect on ATP-dependent ... enzymes for which structural data are available MATERIALS AND METHODS Building the 3D model of PMA1_NEUCR In our approach, the model of PMA1_NEUCR was built using the ATC1_RABIT crystal structure as ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol...
- 13
- 514
- 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
- 24
- 604
- 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... collection and analysis, and with DB collected all data All authors were involved in the development of the scale and the interpretation of the results, helped draft the manuscript, and read and approved ... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... range of each measure across included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics...
- 12
- 379
- 0
báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt
... loss of functional competence of the spermatozoa The major advantage of AFM in pathological studies of spermatozoa is that it allows the evaluation of position and form of the acrosome Electron ... analyses of acrosome intact and acrosome-reacted human sperm heads [9] Structural changes of the hamster sperm head surface associated with maturation, capacitation and acrosome reaction has also been ... indicates that the area of medial sagittal plane of the anterior portions of acrosome-reacted sperm heads is approximately 40% less than those of intact heads Morphological alterations in spermatozoa...
- 6
- 363
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... by a small sample size, the limited representativeness of participants, the lack of a comparison, and the assessment of intermediate outcomes For example, we have not evaluated the impact of the ... Italy: Center for the Evaluation of Effectiveness of Health Care (Ce.V.E .A. S.), Modena Partner manager – Alessandro Liberati The Netherlands: Centre for Quality of Care Research, University of ... Hôtel Dieu, Paris Partner manager – Pierrre Durieux Italy: Unit of Clinical Governance, Agenzia Sanitaria Regionale (Regional Health Care Agency) of Emilia-Romagna, Bologna Partner manager – Roberto...
- 7
- 429
- 0
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... histomorphological evaluation DB was responsible for the surgical part of the investigation CM and ARR carried out the LIFE/DEAD-assay and 2-photon microscopy PZ was involved in the design of the study, evaluation...
- 11
- 573
- 0
Báo cáo sinh học: " Jane: a new tool for the cophylogeny reconstruction problem" ppt
... default This process is repeated and nodes b and c are placed in times and Table shows the table at this point Now, d and f are candidates for time In general, the algorithm chooses the candidate ... the graphical user interface but can be set in the command-line version of Jane Values of these parameters were systematically evaluated and the best values found are used as defaults Jane can ... problem and a software package called Jane that implements our technique (The name “Jane” is used to indicate that this tools is complementary to Tarzan.) Specifically, Jane uses a dynamic programming...
- 10
- 551
- 0
Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot
... on the array, the geometric mean of the measured fluorescence intensities was calculated for both the experimental and control and the ratio of these was used as a scaling factor to adjust the ... of the expression studies AP performed many of the expression studies and the ChIP-chip analysis VL performed the ChIP-chip analysis CD participated in the design and printing of the array and ... University was supported by a grant from the National Institute for Allergy and Infectious Diseases, National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share...
- 15
- 376
- 0
Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx
... searching and querying capa- interactions SO also greatly facilitates the automatic validation of annotation data, as the relationships implied by an annotation can be compared to the allowable ... practical utility of SO as a tool for data management and analysis, we have used SO to name and enumerate the parts of every protein-coding annotation in the D melanogaster genome Doing so has allowed ... the data are complex The more formal approach afforded by SO means that analyses can be easily be extended beyond the domain of transcripts and exons to include many other gene parts and relationships...
- 12
- 299
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008