a useful tool in the determination of the electrophilic character of benzofuroxans case examples of the reactions of nitrobenzofuroxans with dienes and nucleophiles
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T ... discovery of a SNP that adds an extra cysteine into the amino acid sequence of leptin, combined with a signicant association to carcass fat measurements and signicant variation in the level of mRNA detected ... breeds (Angus and Hereford) are characterized by their early maturity as compared to continental breeds (Charolais and Simmental), giving them the capacity to carry more fat at a younger age [10]...
- 12
- 321
- 0
Báo cáo y học: "RNA interference: more than a research tool in the vertebrates'''' adaptive immunity" ppsx
... interferon-mediated activation of the JAK/STAT (Janus kinase/signal transducer and activator of transcription) pathway and global up-regulation of interferon-stimulated genes This process is regulated in part ... that some of the mammalian virus-encoded proteins, such as influenza viral protein NS1 and vaccinia viral protein E3L, have a negative regulatory role on RNA silencing in both plant and insect cells, ... Atkinson P, Brydon EW, Johnson KL, Garcia-Sastre A, Ball LA, Palese P, Ding SW: Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing Proc Natl Acad...
- 4
- 244
- 0
Artificial Neural Networks - a Useful Tool in Air Pollution and Meteorological Modelling pdf
... performance much more than the training algorithms and other details of the establishment of the model This is caused by the fact that the information carried in the features and patterns of the available ... quality a special index was defined – the weighted sum of the standard deviation of wind speed and the standard deviation of wind direction within the obtained groups The natural number of groups was ... train and verify the model In contrast to the SO2 forecasting problem, this problem again has a small data base consisting of weeks of half hour average values of wind speed and direction measurements...
- 15
- 337
- 0
Báo cáo y học: "A GA microsatellite in the Fli1 promoter modulates gene expression and is associated with systemic lupus erythematosus patients without nephritis" potx
... collection and analyses and drafting and editing of the manuscript All authors read and approved of the final manuscript Competing interests The authors declare that they have no competing interests ... experimentation, P/R transfections and data collection EKG performed the statistical analyses of the data JLS participated in the data analyses and writing of the manuscript DLK and GSG provided the ... The raw sizing data were visually analyzed for peak quality followed by analysis and binning using the GeneMapper software (Applied Biosystems, Carlsbad, CA, USA) Direct sequencing of 32 of the...
- 9
- 268
- 0
Báo cáo y học: "Hyperinsulinemia-euglycemia therapy: a useful tool in treating calcium channel blocker poisoning" pps
... Critical Care Vol 10 No Boyer and Levine failing if the therapy was administered, for example, at the end of cardiopulmonary resuscitation After all, when the myocardium dies, along with the body ... for the treatment of calcium channel blocker poisoning in humans? It may be difficult Although calcium channel blocker poisoning is a common cause of pharmaceutical overdose death in the USA, the ... Hyperinsulinemia/euglycemia therapy in the management of overdose of calcium channel blockers Crit Care 2006, 10:212 Kline J, Leonova E, Raymond R: Beneficial myocardial metabolic effects of insulin during...
- 2
- 124
- 0
Báo cáo y học: " Decrease in expression of bone morphogenetic proteins 4 and 5 in synovial tissue of patients with osteoarthritis and rheumatoid arthritis" ppt
... recruitment and data evaluation FS, GAM and GRB provided substantial input into data evaluation All authors read and approved the final manuscript 13 14 15 16 17 Acknowledgements The authors thank Johanna ... attractive candidates for readjustment of an unbalanced intra-articular milieu dominated by destruction and lack of repair Materials and methods Patients and tissue samples Synovial tissue samples ... with hematoxylin Statistical analysis Statistical analysis was performed with GraphPad software (GraphPad Sofware Inc., San Diego, CA, USA) For microarray analysis a t test was used with Bonferroni-Holm...
- 10
- 530
- 0
Báo cáo y học: "Rare incidence of methotrexate-specific lesions in liver biopsy of patients with arthritis and elevated liver enzymes" potx
... metabolic abnormalities, namely diabetes, and alcohol intake In the other changes, the heterogeneity of the histological lesions (that is, mainly AIH-like and NASH-like) and the fact that none of these ... (biliary alterations, vascular changes, and so forth) Statistical analysis Analysis of variance was performed to test the effect of diagnostic group and type of biopsy finding on mean age, disease ... Cronstein BN, Naime D, Ostad E: The antiinflammatory mechanism of methotrexate Increased adenosine release at inflamed sites diminishes leukocyte accumulation in an in vivo model of inflammation...
- 7
- 260
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... from the National Science and Engineering Research Council of Canada S Seah thanks the Canadian Foundation for Innovation and Ontario Innovation Trust for infrastructure support We thank Valerie...
- 9
- 461
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... running the project CR was responsible for the statistical analyses All authors interpreted the data and findings CR wrote the first draft of the manuscript, all authors read and approved the final ... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all statistical analyses, the three targeted tests are reported and analysed separately...
- 9
- 367
- 0
báo cáo khoa học: " NorthStar, a support tool for the design and evaluation of quality improvement interventions in healthcare" ppt
... integrated and practical tool to assist QI researchers, healthcare professionals, and managers responsible for developing, delivering and evaluating CE and QI programmes at a national or regional ... what and how of measuring baseline performance defined as the measurement of actual clinical practice and its comparison to desired clinical practice (Measuring Baseline Performance) NorthStar ... simple to read, pragmatic and focused on assisting the user in developing and evaluating the QI intervention In addition, NorthStar is available as both a browser-based version and an HTML help...
- 7
- 429
- 0
Báo cáo y học: " Implementation of a delirium assessment tool in the ICU can influence haloperidol use" doc
... MvdB carried out the study, gathered all data, performed the statistical analysis, and drafted the manuscript PP and LS supervised the conduct of the study and writing of the paper HvdH and TvA corrected ... convinced that the intensive feedback and support of the project leader and the medical and nursing staff played an important role in achieving a high compliance Haloperidol treatment and patients ... before and after the implementation of the CAM-ICU, we used the total of 641 patients, because of the lack of information of the patients in the period before the implementation Available online...
- 7
- 291
- 0
A study of politeness strategies in requests in the course book ''streamline english departures and connections'' by b hartley & p viney
... the hearer and the speaker; the social distance between the hearer and the speaker, and the ranking of the imposition involve in doing the face threatening act In requesting, some factors plays ... strategies In everyday interaction, people always adapt them to different situations and tend to maintain one anothers face continuously They try to avoid causing damage to each other and therefore, ... are the basic wants in any social interaction, and so during any social interaction, cooperation; cooperation is needed among the participants to maintain each others faces 1.3.4.2 Face-threatening...
- 68
- 716
- 6
Focus - A simplicity manifesto in the Age of Distraction
... struggles we face these days, from being productive and achieving our goals, to getting healthy and fit in the face of fast food and inactivity, to finding simplicity and peace amidst chaos and confusion ... general idea Again, start with half a day or a day — something manageable Do it once a week, and gradually expand the time you spend on the cleanse Reducing the Stream If you’ve done the cleanse, ... an email or chatting In fact, it’s almost impossible to these things and create at the same time Sure, you can switch back and forth, so that you’re creating and engaging in any of these activities...
- 121
- 552
- 1
Tài liệu Báo cáo khoa học: What makes biochemical networks tick? A graphical tool for the identification of oscillophores ppt
... negative when the substance on the right is a substrate of the reaction Then the arrow points backward, i.e away from the substance and there is a right-hand factor a equal to )1 In uences of the ... pÕ in the network That each coefficient of characteristic equation therewith corresponds to a sum of minus paths in the network, is the basis of the graphical analyses of the characteristic equation ... occur in that subnetwork We shall speak of a negative subgraph in this case We define the value of a subgraph that contains p reactions and p concentrations, as minus the sum of all its combined autoinfluence...
- 11
- 638
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... detected in WSM, WIM, EDTA-SM and EDTA-IM The comparison of the amino acid composition of the main peak obtained from AE-HPLC of WSM and EDTASM is given in Table These two peaks were characterized ... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot...
- 10
- 731
- 0
Tài liệu Báo cáo khoa học: A point mutation in the ATP synthase of Rhodobacter capsulatus results in differential contributions of DpH and Du in driving the ATP synthesis reaction pptx
... When the assay contained valinomycin, the data reported in Fig 1B were obtained In this case, the ATP yield of both wild-type and mutant as a function of illumination time presented a lag phase ... the data obtained in the absence of Du (C) The ratio of the best-fitting functions and of the data points of wild-type over mutant are plotted for data in the presence (d) and absence (m) of Du ... appreciated by taking the derivative of the fitting functions of the mutant and wild-type data and plotting their ratio, as in Fig 1C This derivative represents the rate of ATP synthesis at each...
- 9
- 580
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
... necessary for the arrival of the captain commander in this city" Owing to casualties of service, I had almost continually commanded the company, its train, and the general engineer train of the army for ... had acquired at Metz In the meantime we taught him, at the same place, the manual of arms and Infantry tactics which had been introduced into the army after he was graduated at the Military Academy ... done with the sergeant." Except this case, of "the cook", there had been no difficulty in bringing the men of the company to a high standard of drill and discipline as an infantry company, and a...
- 48
- 504
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... side-chain could produce steric clashes with the aromatic ring of Tyr269, and these unfavorable interactions could lead to a decrease of local flexibility and an increased Ea value The validity of the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A/ Y26 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation...
- 6
- 488
- 0
Báo cáo khoa học: A single mismatch in the DNA induces enhanced aggregation of MutS Hydrodynamic analyses of the protein-DNA complexes pot
... 5¢-TCACCATAGGCATCAAGGAATCGCGAATCCGCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCG ATTTCGACACAATTTATCAGGCGAGCACCAGATTCAGCAATTAAGCTCTAAGCC- 3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ ... 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGATCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ 5¢-TCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCCATGTTACTTAGCCGGAACGAGGC-3¢ ... ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GGCTTAGAGCTTAATTGCTGAATCTGGTGCTCGCCTGATAAATTGTGTCGAAATCCGCGACCTGCTCC ATGTTACTTAGCCGGAACGAGGCGGATTCGCGATTCCTTGATGCCTATGGTGA-3¢ 5¢-GCCTCGTTCCGGCTAAGTAACATGGAGCAGGTCGCGGATTTCGACACAATTTATCAGGCGA-3¢...
- 16
- 397
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008