unit1: A visit from a pen pal
unit1: A visit from a pen pal
- 172
- 3,846
- 4
A visit from a pen pal
... www.videobook.vn UNIT 1: A VISIT FROM A PEN PAL (Chuyến viếng thăm c a một người bạn qua thư) 1. Vocabulary pen pal (n): bạn qua thư (ch a gặp mặt) to correspond (v) (with sb): trao đổi thư từ Ex: ... yard is separated from the factory by a tall fence. (Sân nhà họ được ngăn cách với nhà máy bằng một hàng rào cao.) -» separate (adj): riêng biệt; khác nhau —» separation (n): sự chia ... of South East Asian Nations: Hiệp hội các nước Đông Nam Á Website học trực tuyến – www.videobook.vn to divide (v) (into sth): chia, chia ra Ex: The teacher divided the class into small groups....
- 5
- 1,665
- 0
Unit 1: A visit from a pen pal
... Period: 06 Date of teaching: September 20 th , 2006 UNIT 1 : A VISIT FROM A PEN PAL LESSON 6 : LANGUAGE FOCUS I. Objectives : _ Practice in past simple and past simple with wish _ ... students will be able to use past simple, and past simple with wish II. Language contents: 1. Grammar : 2. Vocabulary : III. Techniques : Eliciting questions, asks and answers IV. Teaching aids : Textbook, ... questions about what Ba, Nga, Lan, Nam and Hoa did on the weekend ( exercis1/ P 11) +Tell them that the activities happened in definite in the past. + Let students practice in groups + Ask students...
- 2
- 1,081
- 0
Unit 1: A visit from a pen pal
... Call some students go to the board and write down. + Lan’s Malaysian pen pal came to visit her in Hanoi . Can you guess where she went and what she did during her stay ? + Ask students to read ... Date of teaching : September 13 th , 2007 UNIT 1 : A VISIT FROM A PEN PAL LESSON 1 : GETTING STARTED & LISTEN AND READ LANGUAGE FOCUS 3 I. Objectives : _ To introduce the topic and new material ... Contents and techniques Students’activities Warm up Presentation Practice + Teacher’s questions • Do you have any pen pal ? • Where does she / he live ? • What activities would you do during the visit...
- 3
- 933
- 0
Unit 1_ A visit from a penpal
... Compulsory second language Unit 1: a visit from a pen pal Imagine a foreign pen pal is coming to stay with you for a week, what activities are you planning for him/her during the visit? 1. to______________________( ... the places they visited. Answer these Qs. Created by TTM_titiempi Malaysia Viet Nam Area Population Capital city Climate Unit of currency Official religion ( & others ) National language ... ever arranged to meet each other? Do you know these places? 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 1. Lan met her Malaysian pen pal, Razali Maryam last week. Listen and...
- 4
- 552
- 0
unit 1: A visit from a penpal- t3,t4
... Tim and Carol are and that they are doing. - Listening and choosing the correct answers. - Comparing their answers with the partner’s. * key: a- 1 b-2 c-2 where Tim and Carol are and that they are ... map? 2. Which city is the capital of Vietnam? 3. How many regions are there in Vietnam? 2- While- reading - T introduce a the passage by showing the map and the picture about Malaysia. - T asks ... “What do you know about Malaysia. - T asks sts to read the passage silently and underline the new words. - T explains new word (translation method) - T reads the passage and students listen and...
- 6
- 630
- 0
A VISIT FROM PEN PAL
- 14
- 449
- 0
Gián án Visit from a pen pal
... VISIT FROM A PEN PAL Lesson 2 Speak (Page 6-7)I. Objectives: By the end of the lesson, Ss will be able to make and respond to introduction as well as know how to scan for specific information ... 4 d 2 e 3 a 6- Controlled PracticeSubstitution Drill- ProductionPersonalization- T introduces 2 characters Maryam and Nga, they are waiting for outside the school, they are talking together. ... dialogue in the correct order.- Ss give their answers.- T gives feedback.- T and Ss translate the dialogue to understand it.- T calls 2 pairs repeat the dialogue after getting them repeat...
- 2
- 386
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... cttgtacacaccgcccgtc Primer and Probe Sequence (5’-3’) Reference MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc ... algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura. Environ.Tech., 14, 433-442. Park H.-D., Iwami C., Watanabe M. F., Harada K.-I., Okino T. and Hayashi H. (1998). Temporal variabilities ... Quality., 13, 61-72. Park H. D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A. and Kato K. (2001). Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from...
- 9
- 522
- 0
MONETARY TRANSMISSION MECHANISM: A VIEW FROM A HIGH INFLATIONARY ENVIRONMENT pdf
... disinflationary programmes led agents to form their expectations based on timely data such as changes in interest rates and the exchange rate. Additionally, the Central Bank’s actions allowing a ... exchange rate and interest rate which are available at a high frequency and set in their anticipation of future inflation. In the framework of the model, inflationary expectations are assumed ... ollowing a price targeting strategy, that is the real exchange rate, Central Bank had to adjust its purchases and sales of foreign exchange that led to a depreciation rate in line with the inflation...
- 41
- 271
- 0
Từ khóa: bạn soạn tiếng anh unit 1 a visit from a pen pala visit from a pen pal listenunit 1 a visit from a pen pal writeunit 1 a visit from a pen pal speakunit 1 a visit from a pen pal language focusa visit from a pen pallanguage focusa visit from a pen pal getting starteda visit from a pen pal writea visit from a pen pal speaka visit from a pen pal readenglish 9 unit 1 a visit from a pen pal getting startedbai giang unit 1 a visit from a pen pal speakenglish 9 unit 1 a visit from a pen pal speakunit 1 a visit from a pen pal lesson 2 speakunit 1 a visit from a pen pal speak and listen pptNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ