0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Ngữ pháp tiếng Anh >

Effects of compost, mycorrhiza, manure and fertilizer on some physical properties of a Chromoxerert soil

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available from the Protein Data Bank and ... W, Thanki N, Jaenicke R & Wierenga RK (1997) A double mutation at the tip of the dimer interface loop of triosephosphate isomerase generates active Effect of mutation on the dimer interface of...
  • 15
  • 635
  • 0
Effects of cattle and poultry manures on organic matter content and adsorption complex of a sandy soil under cassava cultivation (Manihot esculenta, Crantz) doc

Effects of cattle and poultry manures on organic matter content and adsorption complex of a sandy soil under cassava cultivation (Manihot esculenta, Crantz) doc

... Responses in soil organic matter content at - 22 and 22 - 55 cm soil layers in the sandy soil under cassava cultivation at 15 months after planting, according to fertilisation mode during the consecutives ... 0-22 22-55 Soil layers (cm) Figure Responses in soil cation exchange capacity at - 22 and 22 - 55 cm soil layers in the sandy soil under cassava cultivation at 15 months after planting, according ... sum of the exchangeable bases cations at - 22 and 22 - 55 cm soil layers in the sandy soil under cassava cultivation at 15 months after planting, according to fertilisation mode during the conse-cutives...
  • 8
  • 416
  • 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... a GGN4 analogue with both the C-terminal 14 residue truncation and the substitution of the aspartic acid at position 16 by tryptophan, showed antimicrobial activity comparable to that of native ... the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with a slight ... perpendicular to the helical axis in panels A and B, and is parallel to the helical axis in panels C and D rapid exchange of the Hz amino protons This observation indicates that the lysine side-chains are...
  • 8
  • 447
  • 0
báo cáo hóa học:

báo cáo hóa học: " e differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults" pptx

... et al.: The differential mediating effects of pain and depression on the physical and mental dimension of quality of life in Hong Kong Chinese adults Health and Quality of Life Outcomes 2010 8:1 ... mediation is established if the association between depression and QoL is reduced to zero The Sobel test [24] determined whether pain carried the influence of depression to QoL These criteria were ... pain- depression- QoL mediation chain by testing the differential effects on the physical and mental dimension of QoL independently Regression analyses showed that pain and depression impacted differently...
  • 6
  • 521
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Effects of a clear-cut on the in situ nitrogen mineralisation and the nitrogen cycle in a 67-year-old Douglas-fir (Pseudotsuga menziesii (Mirb.) Franco) plantation" potx

... lower than mineralisation Mineralisation and root uptake were generally lower during the winter season, but the dormant season is probably shorter than months, and a part of the calculated fluxes ... Pietikọinen and Fritze [63] measured no increase in nitrification in non-nitrifying soil, although mineralisation increased Finally, Barg and Edmonds [4] found no change in mineralisation and nitrification ... Throughfall and seepage water containers and the two winter stemflow containers were placed in closed pits and protected against freezing, light and variations in temperature [54] Containers were sampled...
  • 12
  • 432
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Effects of a calcium deficiency on stomatal conductance and photosynthetic activity of Quercus robur seedlings grown on nutrient solution" pdf

... after stabilisation of stomatal conductance, the shoot was transferred to a tube containing an aqueous solution of ABA (10 M) Stomatal conductance was fol-3 lowed with a porometer (Delta-T Device, ... maintenance of CO concentrations in the sub2 stomatal spaces (c and a decrease of CO ) i at the carboxylation sites (c In contrast, ) c the activation state of Rubisco was reduced to 80% We may ... (Schroeder and Hagiwara, 1989) The calcium deficiency in oak leaves resulted in an uncomplete stomatal closure under darkness Thus, we may state that decreased availability of calcium at leaf level...
  • 11
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: "Demonstration of the histopathological and immunohistochemical effects of a novel hemostatic agent, ankaferd blood stopper, on vascular tissue in a rat aortic bleeding mode" pps

... experimental study, we investigated the effects of ABS on vascular tissue in a rat model of aortic bleeding Methods Wistar albino (WA) rats were used to demonstrate the vascular histopathological and immunohistochemical ... with the “Principles of Laboratory Animal Care” formulated by the National Society for Medical Reseacrh and “Guide for the Care and the Use of Laboratory Animlas” prepared by the US Natinoal Academy ... in vascular tissues, inflammatory reaction, and endothelial cell loss are important, particularly in terms of graft patency Intimal hyperplasia can cause aneurysm and thrombus formation [1] In...
  • 7
  • 454
  • 0
báo cáo khoa học:

báo cáo khoa học: " Short- and long-term effects of a quality improvement collaborative on diabetes management" pptx

... multifaceted implementation approach emphasizing collaborative learning and exchange of insights and support among a set of healthcare organizations, like a quality improvement collaborative ... albumin, and BMI per patient per year were performed Data about annually foot and eye examinations, consultations with dieticians and podiatrists, and counseling (advice and instruction to monitor ... package of ideas (change concepts) for closing the gap between best and actual practice The package was based on national and international diabetes guidelines, field surveys, personal experience, and...
  • 10
  • 295
  • 0
Báo cáo y học:

Báo cáo y học: " The effects of a commercially available botanical supplement on strength, body composition, power output, and hormonal profiles in resistance-trained males" docx

... Study of Galactomannan on Androgenic and Anabolic Activity in Male Rats Pharmacology Online 2008, 56-65 40 Ratamess NA: Adaptations to Anaerobic Training Programs Essentials of Strength Training ... performance and hormonal changes in animal as well as human populations The commercially available supplement nonsignificantly impacted muscular endurance, hormonal concentrations and hematological ... purpose of this study was to determine the effects of a commercially available supplement containing Trigonella foenum-graecum on strength, body composition, power output, and hormonal profiles in resistance-trained...
  • 9
  • 568
  • 0
Báo cáo y học:

Báo cáo y học: "Evaluation of the effects of a VEGFR-2 inhibitor compound on alanine aminotransferase gene expression and enzymatic activity in the rat liver" pdf

... morphometry Clinical pathology ALT, ALP, and AST activity was measured in the serum of compound- treated and control rats and results are presented in Table On day of treatment, AG28262 induced a statistically ... activity of ALT, AST, and ALP suggesting that AG28262 induces hepatic injury Clinical chemistry data demonstrated a statistically significant increase in serum ALT, ALP activities, and increased ... VEGFR-2 inhibitor compound on alanine aminotransferase gene expression and enzymatic activity in the rat liver Comparative Hepatology 2011 10:8 Submit your next manuscript to BioMed Central and take...
  • 7
  • 339
  • 0
Báo cáo y học:

Báo cáo y học: "Effects of a fish oil containing lipid emulsion on plasma phospholipid fatty acids, inflammatory markers, and clinical outcomes in septic patients: a randomized, controlled clinical trial" docx

... of a fish oil containing lipid emulsion on plasma phospholipid fatty acids, inflammatory markers, and clinical outcomes in septic patients: a randomized, controlled clinical trial Critical Care ... 20:5n-3) and docosahexaenoic acid (DHA; 22:6n-3) in the fish oil containing emulsion where they contribute about 3.6% of fatty acids (2.5% of fatty acids as EPA and 1.1% of fatty acids as DHA) [29] ... there is only limited, and contradictory, information on the influence of fish oil containing parenteral nutrition in septic ICU patients on markers of inflammation and on clinical endpoints However,...
  • 11
  • 388
  • 0
Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice

Sequential effects of a high fat, calorie dense diet or a high fiber diet on gene expression, body weight and associated metabolic responses in c57 BL6J mice

... Plasma insulin levels 42 Plasma leptin levels 43 Statistical analysis 44 iv CHAPTER SEQUENTIAL EFFECTS OF A HIGH- FAT, CALORIE- DENSE DIET ON FOOD INTAKE, BODY WEIGHT, PLASMA LIPIDS, LEPTIN AND GENE ... increasing in both prevalence and severity It is associated with increased risks of type diabetes and cardiovascular disease Increased food intake, particularly a diet high in calories and fat ... the findings on gene expression induced by a high- fat, calorie dense diet could be due to the difference in duration of the feeding period and that the ingestion of the highfat, calorie dense diet...
  • 228
  • 231
  • 0
Effects of a chair yoga exercises on stress hormone levels, daily life activities, falls and physical fitness in institutionalized older adults

Effects of a chair yoga exercises on stress hormone levels, daily life activities, falls and physical fitness in institutionalized older adults

... was able to maintain the and physical fitness and levels of stress hormonals (sCOR and sAA) protecting against stress and infection; • This study revealed that hormonal levels of stress are a promising ... ACCEPTED MANUSCRIPT SC RI PT Effects of a chair- yoga exercises on stress hormone levels, daily life activities, falls and physical fitness in institutionalized older adults Furtado, GE1, *, Uba-Chupel, ... was to evaluate the effects of a chair- based yoga exercise program on stress hormone levels, ADL, fear of falling and PF in institutionalized older adults EP Methods 2.1 Initial Procedures AC...
  • 31
  • 677
  • 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot

... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... were all effective methyltransferase inhibitors Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was minimally active against a cellular PRMT substrate [8] Computational ... K Bonham et al 11 Clarke SG (2006) Inhibition of mammalian protein methyltransferases by 5¢-methylthioadenosine (MTA): a mechanism of action of dietary SAMe? In The Enzymes: Protein Methyltransferases...
  • 13
  • 646
  • 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt

... control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact peptide at t ¼ and t ¼ 60 Binding assays Binding assays were carried ... [33], the peptides containing a b-amino acid substitution in position have increased stability compared to the corresponding a- amino -acid- containing peptides Therefore it is possible to increase peptide ... acid incorporation When Phe7 or Phe8 are replaced by b2-HPhe, the corresponding analogues are weak competitors of specific NK-1 binding sites These amino acids are in the helical domain of SP which...
  • 11
  • 860
  • 0

Xem thêm

Từ khóa: effects of core and cladding on optical guidance properties of holey fibersdynamic effects of a temporary reduction in oil supply in the rest of the world on a small open oil exporterdynamic effects of a temporary increase in liquidity in the rest of the world on a small open oil exporterexperimental evaluation of the preventive and therapeutic effects of a moisturizerantioxidant anticancer activity and other health effects of a nutritional supplement galaxy rvariety baking procedure and storage on the antioxidant properties of breads with added barley flourseffects of various synthetic soil amendments on sinformation on the estimation criteria applied and the possible impact on the financial statements or where this is impracticable a statement to that effect and information on the uncertainties preventing such a calculationclinical effects of a robotic gait trainingthe health effects of a psychosocial work stressoreffects of a lifestyle interventioneffects of a money supply increaseeffects of a taxeffects of ozone layer depletion on plants and animalseffects of ozone depletion on humans and plantsBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ