0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

Trust: Economic Notions and its role in Money and Banking

Trust: Economic Notions and its role in Money and Banking

Trust: Economic Notions and its role in Money and Banking

... 156 10 Trust: Economic Notions and its role in Money and Banking – An Introduction The purpose of the thesis is to explore and develop the understanding of trust in economics, applying it to ... understanding and trust are too important to me to be able to express properly in this hastily written note Contents Abstract Trust: Economic Notions and its role in Money and Banking ... aims; to explore the economic notions of trust to develop a coherent understanding of trust within economics and to apply this understanding to the operation of money and banking There has been...
  • 164
  • 376
  • 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regions for the v-KIND–MAP2 interaction and showed that the ... both KIND1 and KIND2; DRasN, deletion of RasN; DGEF, deletion of RasGEF; KIND1, KIND1 domain; KIND2, KIND2 domain (B) KIND2 domain anchors v-KIND to dendrites Flag-tagged v-KIND, DKIND1, DKIND2,...
  • 11
  • 658
  • 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for exon ... reverse transcriptase (Promega, Madison, WI, USA) For PCR of occludin variants, the primers used were: 5¢-ACTCGACAATGAACAATCCGTCAGAA-3¢ (sense) and 5¢-AGAGTATGCCATGGGACTGTCA-3¢ (antisense) for exon...
  • 12
  • 613
  • 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... interface formed in the tetramer would disrupt copper < /b> binding < /b> Inhibition of amyloid fibril formation by < /b> stefin < /b> B in presence of copper < /b> The mechanism of amyloid fibril formation of cystatins is being studied ... histidine residues are central to copper < /b> binding < /b> in many proteins they probably form part of the copper < /b> binding < /b> sites in this protein Although there are four histidines in the C-terminal, another ... copper < /b> binding < /b> or loss of its binding < /b> could be related to specific cerebellar function(s) of stefin < /b> B [18], which remains to be seen by < /b> more in vivo studies Stefin < /b> B as a copper < /b> binding < /b> protein We...
  • 14
  • 586
  • 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human AUH protein was first recognized by its ... confirmation of AUH deficiency in fibroblast homogenates In summary, our data show that the main biological function of AUH in human metabolism is the hydration of (E)-3-MG-CoA to (S)-HMG-CoA in the leucine...
  • 11
  • 625
  • 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of the L3 cuticle Results Identification of cDNA ... involved in the molting process, we examined the effects of two PPase specific inhibitors, imidodiphosphate (IDP, 1-0631; Sigma) and NaF on development and molting of A suum lungstage L3 to fourth-stage...
  • 13
  • 691
  • 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
  • 12
  • 561
  • 0
Solar and Space Physics and Its Role in Space Exploration doc

Solar and Space Physics and Its Role in Space Exploration doc

... Printing Office, Washington, D.C., 2004 SOLAR AND SPACE PHYSICS AND ITS ROLE IN SPACE EXPLORATION the fundamental role of solar and space physics research both in scientific exploration and in ... Solar and Space Physics and Its Role in Space Exploration Committee on the Assessment of the Role of Solar and Space Physics in NASA’s Space Exploration Initiative Space Studies ... variations in solar 10 SOLAR AND SPACE PHYSICS AND ITS ROLE IN SPACE EXPLORATION BOX 1.4 Reconnection Explosive events in the Sun’s corona, including solar flares and coronal mass ejections, and in planetary...
  • 74
  • 369
  • 0
Interest Rate Policy in Egypt - Its Role in Stabilization and Adjustment pdf

Interest Rate Policy in Egypt - Its Role in Stabilization and Adjustment pdf

... discounted A Interest Rate and Business Investment The first step in examining how higher interestrates may influence business investmentdecisions and performances is the understandingof firms' ... rate of inflation,measured by WPI in the U.S Rate by ratemeasured LondonInterBankBorrowing r* =foreign nominalinterest (LIBOR); x - domestic rate of inflationmeasured by WPI in Egypt; and r - ... REMITTANCES C 20 20 INTEREST RATE AND INVESTMENTEFFICIENCY OF IMPLICATIONS HIGH INTEREST RATES V 16 .3 23 A B VI 24 INTEREST RATE AND BUSINESS INVESTMENT IMPACT ON THE SECTOR BANKING POLICY IMPLICATIONS...
  • 39
  • 368
  • 0
Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

Báo cáo khoa học: Characterization of Trypanosoma brucei PEX14 and its role in the import of glycosomal matrix proteins pptx

... We interpret this observation as the retainment of newly synthesized proteins in the cytosol due to the inability to import matrix proteins by the fraction of growing and dividing glycosomes The ... lower (not shown) In order to determine the in uence of the reduction of the expression of TbPEX14 on the import of glycosomal matrix proteins, the subcellular distribution of glycolytic enzymes ... identified in yeast) PEX17 Several other peroxins are involved in the subsequent steps of the import The import of matrix proteins seems to involve a cascade of interactions between the cargo-loaded...
  • 9
  • 549
  • 0
Báo cáo y học:

Báo cáo y học: "ignal 3 and its role in autoimmunity" pot

... B7/CD28dependent and -independent induction of CD40 ligand expression J Immunol 1995, 155:5124-5 132 Curtsinger JM, Schmidt CS, Mondino A, Lins DC, Kedl RM, Jenkins MK, Mescher MF: Inflammatory cytokines ... Available online http://arthritis-research.com/content/6/1/26 known roles in tissue inflammation, and damage in innate immunity Besides its capacity to drive the production of IFN-γ and IL-2 by CD4+ ... tolerance in the thymus Competing interests None declared References 5.* 10 11 12 13. * 14 15 16 Delon J, Stoll S, Germain RN: Imaging of T-cell interactions with antigen presenting cells in culture and...
  • 2
  • 317
  • 0
Báo cáo y học:

Báo cáo y học: "Circadian rhythm and its role in malignancy" docx

... temporally coordinated physiology [23-25] Indirect synchronization is achieved by controlling daily activity-rest cycles and, as a consequence, feeding time Feeding (or starving) cycles are dominant ... b-catenin signaling and cell proliferation Also, increase in small-intestinal mucosa b-catenin in Per2m/m mice is associated with an increase in MYC protein, again a circadian regulated and b-catenin ... regulating the circadian clock include acetylation, phosphorylation, ubiquitination and sumoylation In terms of phosphorylation, Casein kinase epsilon (CK1ε) and Casein kinase delta (CK1ε and CK1δ),...
  • 13
  • 464
  • 0
Báo cáo y học:

Báo cáo y học: " Th2 cytokines and asthma Interleukin-4: its role in the pathogenesis of asthma, and targeting it for asthma treatment with interleukin-4 receptor antagonists" pot

... circulating cytokine, coupled with the high specificity and high affinity of binding for the cytokine, makes the soluble receptor ideal as a cytokine antagonist Soluble recombinant human IL-4 receptor ... heterodimer of high-affinity IL-4Rα and either the common γ chain or the IL-13 receptor α chain Binding of IL-4 results in the tyrosine phosphorylation of signal transduction molecules including motifs ... chains of the heterodimer are required to initiate intracellular signaling (b) The sIL-4R consists of the extracellular portion of IL-4Rα It retains the ability to bind IL-4 with high affinity and...
  • 5
  • 365
  • 0
Báo cáo y học:

Báo cáo y học: " Beyond the first 25 years: The International AIDS Society and its role in the global response to AIDS" pps

... at ways to strategically expand its role in this area in order to strengthen the capacity of the HIV workforce The IAS has been increasingly involved in policy and advocacy debates over the past ... science, to broaden diversity, to facilitate cross-disciplinary linkages and dialogue, and to strengthen the focus on youth – began to be implemented in the planning for the XVI International AIDS ... development and networking opportunities to meet the challenges of the coming decades The IAS has a unique opportunity – and responsibility – to bring together individuals working in diverse settings and...
  • 3
  • 201
  • 0
Báo cáo y học:

Báo cáo y học: "Downregulation of protein disulfide isomerase in sepsis and its role in tumor necrosis factor-alpha release" pps

... molecular chaperones in the folding of oxidized proteins Refolding of colloidal thyroglobulin by protein disulfide isomerase and immunoglobulin heavy chain-binding protein J Biol Chem 2001, 276:21337-21342 ... Mechanism of hepatocellular dysfunction during early sepsis: key role of increased gene expression and release of proinflammatory cytokines tumor necrosis factor and interleukin-6 Arch Surg 1997, 132:364-370 ... protein disulfide isomerase inhibition on tumor necrosis factor-alpha gene expression and production in RAW 264.7 cells To investigate the role of PDI in the regulation of proinflammatory cytokine...
  • 8
  • 327
  • 0

Xem thêm

Từ khóa: importance of tourism industry and its role in the philippine economyneuroimaging for the affective brain sciences and its role in advancing consumer neurosciencek nutrition uptake and its role in environmental stress in plantsrediscovering red blood cells revealing their dynamic antigens store and its role in health andembryology structure function and its role in fertilization and infertilityil 12 23 and its role in the immunopathogenesis psoriasisits role in pressure control and in hypertensionmolecular functions and its role in virus life cycle and pathogenesisapoptosis and its role in inflammatory diseasenmr and mutagenesis investigations of a model cis trans peptide isomerization reaction xaa sup 116 pro sup 117 of staphylococcal nuclease and its role in protein stability and foldingthe role of the meso diencephalic activating system in higher nervous activity its role in habituation leirning mechanisms and conditioned reflex processes5  the cartilage specific mir 140 and its role in pdgf signalingdyskerin and its role in rrna and ribosomal biogenesisdyskerin and its role in telomeric maintenancethe basics of contrast and its role in datingNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI