The ‘performativity thesis’ and its critics: towards a political ontology of management accounting
A study of semantic and pragmatic features of the adjective warm and its vietnamese equivalents
... Making an investigation of some semantic and pragmatic features of the adjective Warm in English and its equivalents in Vietnamese - Analyzing meanings of the adjective Warm in particular contexts, ... discover, analyze and contrast Some linguists have studied of adjectives as well as semantic and pragmatic characteristics of the adjective Warm and its adjectives of temperature However, the adjective ... language is Vietnamese The data are classified into semantic and pragmatic features The researcher investigates the data taken from CA Warm- blooded literary works and their Vietnamese equivalents, ...
- 13
- 865
- 0
The 1998 bleaching event and its aftermath on a coral reef in Belize doc
... error bars indicates that the error was too small to appear on the graph The asterisk on the abscissa marks the onset of high-temperature anomaly in August 1998 Hard corals include Scleractinia and ... set at 1°C above the local HotSpot thresholds Because data on solar radiation are not available for the study area during the bleaching event, the HotSpot anomalies, bleaching thresholds, and ... coralline algae, fleshy and filamentous macroalgae, and sponges Crustose coralline algae, fine algal turfs (filaments ...
- 13
- 583
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains and a single KH domain similar ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1 (ANKHD1) variants,...
- 12
- 561
- 0
a study of the emergence of management accounting system ethos and its influence on perceived system success
... (TOP) At the heart of this organisational drive, was an attempt to engender greater flexibility of operational practices and an enhanced outward management orientation Many managers across the organisation ... effectiveness and transparency also a ected the form and effects of PBTC Accountants had traditionally internalised a professional conception of the need to economically map the organisation in terms of ... was not conducive to the integration of accounting information with other types of operational data The characteristic Wissenschaft-based approach to economic representations of organisational...
- 26
- 544
- 0
faith and its critics a conversation oct 2009
... concerning its standard claims and practices A liberating humanist alternative is at hand and is confidently asserted as providing a more rational and fulfilling way of life Human societies can flourish and ... Spurway, Sandy Stewart, Alexander Broadie, Graeme Auld, Hans Barstad, George Newlands, Paul Heelas, Iain Torrance, Larry Hurtado and Christian Lange I am especially indebted to my former colleague ... Shanghai Taipei Toronto With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey...
- 204
- 247
- 0
Alexey a zaslavsky, one property of the jerabek hyperbola and its corollaries
... as well as its orthocenter H (in this case, all of A2 , B2 , C2 coincide with H) Therefore, k is the Jerabek hyperbola Here follow some corollaries of this fact ONE PROPERTY OF THE JERABEK HYPERBOLA ... HYPERBOLA AND ITS COROLLARIES 55 Statement Let P be a point on the Euler line of ABC, A1 B1 C1 be the circumcevian triangle of P , and A2 , B2 , C2 be the reflections of A1 , B1 , C1 in the midpoints ... Proof It suffices to apply homothety of center the centroid of ABC and coefficient − to the configuration of the previous claim Statement Let O, I be the circumcenter and incenter of ABC An arbitrary...
- 4
- 347
- 1
Báo cáo y học: "The International Documentation and Evaluation System IDES: a single center observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity" pdf
... observational case series for development of an ankle prosthesis documentation questionnaire and study of its feasibility and face validity Journal of Foot and Ankle Research 2010, 3:4 ... German, French, Spanish and Italian [2] The English and German versions of the IDES ankle series are available under http://www.memdoc.org, the translations into French, Spanish and Italian are ... radiological evaluation AP and lateral images of the ankles were taken in full weight-bearing position An α-angle (AP view: angle between the longitudinal axis of the tibia and the articulating surface...
- 8
- 316
- 0
Báo cáo y học: "Estimation of stature from the foot and its segments in a sub-adult female population of North India" pps
... and its parts in a sub-adult female population of North India Methods The study was conducted in a selected area of Tehsil Kalka, in the District of Panchkula in Haryana state, Northern India ... Estimation of stature from the foot and its segments in a sub-adult female population of North India Kewal Krishan1,*, Tanuj Kanchan2 and Neelam Passi1 Department of Anthropology, Panjab University, ... located in villages Nanakpur, Marranwala and Bassolan of Tehsil Kalka, District Panchkula in Haryana state of North India for allowing data collection Thanks are also due to the subjects who have...
- 33
- 480
- 0
Báo cáo y học: " Profile of subjective quality of life and its correlates in a nation-wide sample of high school students in an Arab setting using the WHOQOL-Bref" pot
... Ministry of Education authorized and facilitated the study The following played invaluable roles in data collection: Zaina Al-Zabin, Nahed Kamel, Abdel W Awadalla, and Sumai (and Ministry of Education ... 0.0001) Covariance analysis It was necessary to analysis of covariance in order to understand the impact of anxiety, depression, selfesteem and difficulty with studies and social relations on the noted ... reflect a circumstance of social disadvantage and poor psychological well-being in which girls fared worse than boys The findings indicate that programs Al-Fayez and Ohaeri BMC Psychiatry 2011,...
- 12
- 500
- 0
Báo cáo y học: "The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challeng" ppt
... RB, Pahuja A, Alleva D, Acosta HM, Martinez C, Ortega A, Lopez A, Araiza-Casillas R, Zlotnik A: Gene array analysis comparison between rat collagen-induced arthritis and human rheumatoid arthritis ... The gene expression profile of preclinical autoimmune arthritis and its modulation by a tolerogenic disease-protective antigenic challenge Hua Yu1, Changwan Lu2,3, Ming T Tan3 and Kamal D Moudgil1,4,* ... development of arthritis and its severity was evaluated regularly by examination of all paws for signs of arthritis, and graded on a scale from 0-4 per paw on the basis of redness, swelling and induration...
- 48
- 317
- 0
Báo cáo y học: "The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions" docx
... Cite this article as: Youngkong et al.: The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation 2011 ... questionnaire, an approach that facilitates MDCA, and distributed this among 24 national health policymakers, 55 health professionals, and 163 general populations Third, our DCE analyses resulted ... Nonthaburi, Thailand 3School of Public Health and Social SciencesMuhimbili, University of Health and Social Sciences, Tanzania Received: 17 January 2011 Accepted: 19 May 2011 Published: 19 May 2011...
- 3
- 276
- 0
Báo cáo y học: "orrection: The EVIDEM framework and its usefulness for priority setting across a broad range of health intervention" pdf
... Correction: The EVIDEM framework and its usefulness for priority setting across a broad range of health interventions Sitaporn Youngkong1,2,*, Noor Tromp1, and Dereck Chitama1,3 Nijmegen International ... and its usefulness for priority setting across a broad range of health interventions Cost Effectiveness and Resource Allocation, 2011 9: p Daniels, N., Accountability for reasonableness: Establishing ... Technology Assessment Program (HITAP), Ministry of Public Health, Nonthaburi, Thailand School of Public Health and Social Sciences-Muhimbili, University of Health and Social Sciences, Tanzania *Corresponding...
- 3
- 228
- 0
Báo cáo y học: "The organisation of the stress response, and its relevance to chiropractors: a commentary" pdf
... pathways, and then projects to central, basal and basal accessory nuclei of the amygdala [28], as well as to the hippocampus, orbitofrontal cortex, cingulate [29] and via the reticular activating ... periphery, though they are able to indirectly and bilaterally influence sympathetic and parasympathetic preganglionic neurons via the efferent paraventricular pathway [18] The hypothalamus is able to ... important information The amygdala has neuronal projections to the paraventricular nucleus of the hypothalamus, and this amygdalo-hypothalamic pathway is believed to influence the activity of the...
- 13
- 382
- 0
NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CHỨA TỪ “HEART” VÀ TỪ ĐỒNG NGHĨA VỚI “HEART” TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ĐỘ VĂN HÓA = english idioms containing the word heart and its synonyms in vietnamese idioms a contrastive analysis from cultural
... VIETNAMESE IDIOMS: A CONTRASTIVE ANALYSIS FROM CULTURAL PERSPECTIVES (NHỮNG THÀNH NGỮ TIẾNG ANH CÓ CH A TỪ HEART VÀ TỪ ĐỒNG NGH A VỚI HEART TRONG THÀNH NGỮ TIẾNG VIỆT: ĐỐI CHIẾU NHÌN TỪ GÓC ... containing the word heart and its synonyms in Vietnamese In each language, idioms containing words of human body part possess a remarkable figure According to statistics in Longman Dictionary ... based idioms in English are ones containing the word heart “Have a big heart, break your heart, follow heart are examples of heart- based idioms in English In Vietnamese, there are more than...
- 51
- 1,069
- 3
Từ khóa: marc hameleers jeroen van den heuvel rijnders and sander baljé towards a smarter protection of public interests in the liberal professions390 guidance for the use of u s customary and si units in the asme boiler and pressure vessel code a 391 use of units in equationstoward a financepeace the integrative mindset of social banking and social finance and its criticsdescription of the subsequent event and its nature the factor that casts doubt upon the company s ability to continue operating as a going concernwhat apos s in a code towards a formal account of the relation of ontologies and coding systemsa brief history of the north atlantic and its resourcesthe basic features of the gimf and its application to a small open oil exportertable a 1 purpose of the expression interface and its implementersevaluation summary report a report issued by an overseer and submitted to an evaluation authority that documents the oversight verdict and its justification 24use set variable to enter the property of a movie clip in the variable field and its new value in the value fieldthe morality of conflict resolution a critique of the state system and its management of sub national conflicta foretaste of paradise the islamic garden and its forebearsa vertical guide appears as soon as you start dragging allowing you to preview the new position of the column edge and its widththe effect of the type of triad that is formed with the third actor and its level of importance on the embedding of a start up in the pre existing networkand its treatment in a machine translation system sBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ