evaluation summary report a report issued by an overseer and submitted to an evaluation authority that documents the oversight verdict and its justification 24
Báo cáo khoa học: "A Method for Relating Multiple Newspaper Articles by Using Graphs, and Its Application to Webcasting" pptx
... Summarization by Graph Search and Matching Proe of AAAI'97, pages 622-628 Y M a a r e k and A Wecker 1994 The Librarian Assistant: Automatically Assemblin Books into Dy- 1313 namic Bookshelves Proc of RIAO ... China, and asks France to understand Japan's position d6: The prime minister of New Zealand asks the French Government not to restart nuclear testing dT: President of France states that nuclear ... then pushed to subscribers who can capture the flow of topics by following the threads In another scenario, when a user gets an article, and wants to see its origin or the next related article,...
- 7
- 419
- 0
REPORT ON STUDIES ON BENCHMARKING /INPUT NORMS FOR PULP AND PAPER INDUSTRY SUBMITTED TO CESS GRANTS AUTHORITY pot
... Compilation of basic input data of different mills and comparison with best achievable national and international standards Arriving at the Benchmark / Norm using various statistical and marking ... important customer of the forestry and, to an extent, the agricultural sectors It therefore forms an integrated part of the development and welfare of rural areas across the globe Being mainly based ... Canada, the pulp and paper sector is the largest 15 10 industrial energy user: and it is the 4th largest energy consumer among countries such as China, India Indonesia, Thailand and Korea Steam...
- 278
- 330
- 0
Báo cáo khoa học: "A Stochastic Language Model using Dependency and Its Improvement by Word Clustering" ppt
... known, as a characteristic of the Japanese language, that each bunsetsu depends on the single bunsetsu appearing just before it We say of two sequential bunsetsu that t h e first to appear is the anterior ... Learning, pages 16 -24 John E ttopcroft and Jeffrey D UUman 1979 In- troduction to Automata Theory, Languages and Computation Addison-~,Vesley Publishing Japan Electronic Dictionary Research Institute, ... Mort and Osamu Yamaji 1997 An estimate of an upper bound for the entropy of japanese Transactions of Information Processing Society of Japan, 38(11):2191-2199 (In Japanese) Shinsuke Mort, Masafumi...
- 7
- 352
- 0
wordpress complete a comprenensive, step-by-step guide on how to set up, customize, and market your blog using wordpress
... integration, and mailing list manager Mailing list manager is a feature through which you can manage a group of users and send mails to them The Drupal administration panel is quite heavy and confusing ... when you are free First of all, I would like to thank David Barnes, Patricia Weir, Abhijeet Deobhakta, Nanda Padmanabhan, Nikhil Bangera, and Priyanka Baruah, without whom the book would have never ... www.packtpub.com Cover Image by www.visionwt.com Credits Author Hasin Hayder Reviewer Nikhil Bangera Development Editor Nanda Padmanabhan Technical Editor Priyanka Baruah Editorial Manager Dipali...
- 302
- 1,908
- 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx
... successfully in case reports and small series, with apparently low acute toxicity [57,63] Long-term safety data are needed Scanty and sometimes contradictory AD animal data are available Although the results ... 2′,3′-dioxygenase (IDO) is an enzyme that is induced by IFN-γ on the surface of antigen-presenting cells and then converts tryptophane to kynurenine The degradation of tryptophane, as an amino acid that ... scarring tissue damage is often present On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly...
- 10
- 559
- 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx
... Transfusion Today 2002, 53:3-4 Alavian SM, Einollahi B, Hajarizadeh B, Bakhtiari S, Nafar M, Ahrabi S: Prevalence of hepatitis C virus infection and related risk factors among Iranian hemodialysis ... study, the dominant genotype(s) in different regions of Iran consist: 1a, 1b and 3a in center and west, 1a and 3a in north and 1a in south and east (table 2) The geographic distribution of the patients ... 17 Authors' contributions HK carried out the molecular genetic studies, the sequence alignment and the immunoassays, and also drafted the manuscript AK and S-MA conceived and coordinated the...
- 6
- 337
- 0
Skkn tiếng anh an investigation into appreciation in perfect spy by larry berman and its vietnamese version điệp viên hoàn hảo by đỗ hùng in perspectives of appraisal th
... of Appraisal language in the story in English and its translational equivalent Semantic aspects as well as the syntax will be examined in view of Appraisal Theory and Functional Grammar where the ... perceive the nature of the appreciation in use and comprehend its syntactic and semantic features of appreciation to approach to aesthetic values that human 23 being always desires Teachers and learners, ... reaction with impact and quality meaning, composition with balance and complexity meaning and valuation meaning Martin & Rose (2003) (2005), Whitelaw, Garag and Argamon (2005), Whitelaw et al...
- 27
- 398
- 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot
... Micciulla, and J Makhoul 2006 A study of translation edit rate with targeted human annotation In Proceeding of AMTA T Takezawa, E Sumita, F Sugaya, H Yamamoto, and S Yamamoto 2002 Toward a broad-coverage ... is a balanced corpus and has 500K sentence-pairs in total We selected 360K sentence-pairs that are more similar to BTEC data according to its sub-topic Additionally, the English sentences of Tanaka ... S Jayaraman and A Lavie 2005 Multi-engine machine translation guided by explicit word matching In Proceeding of EAMT pp.143–152 D Karakos, J Eisner, S Khudanpur, and M Dreyer 2008 Machine Translation...
- 8
- 546
- 1
a brief history of led zeppeln and its musical impact
... official debut, Led Zeppelin were at the top of the bill at the Playhouse Theater in London, and the Pop Proms at the Royal Albert Hall in London On October 17, '69, a year and two days from the bands ... today, is that it doesn't sound dated The music seems similar to music today The lasting impression of their music is obvious, and can be heard in any Rock band of today.Unfortunately, the machine ... #10 in the US and to #6 in the UK Album two, entitled Led Zeppelin 2, moved up to #1 in both the US and the UK, staying on the charts for 98 in the States and an astounding 138 weeks in Britain...
- 3
- 323
- 0
Báo cáo khoa học: Prediction of coenzyme specificity in dehydrogenases ⁄ reductases A hidden Markov model-based method and its application on complete genomes doc
... Chlamydophila caviae (13 proteins), while in archaea the top and bottom is represented by Haloarcula marismortui (146 proteins) and Nanoarchaeum equitans (five proteins) The genomes of Oryza sativa and Xenopus ... Drosophila melanogaster, the worm by Caenorhabditis elegans, and the yeast by Saccharomyces cerevisiae The total column gives the percentage of all proteins of all types and all species included in the ... preference among archaean, bacterial, and eukaryotic genomes Kingdom FAD NAD NADP Archaea Bacteria Eukaryota 0.21 0.21 0.21 0.49 0.46 0.41 0.30 0.33 0.38 Among the annotated human Rossmann proteins,...
- 8
- 481
- 0
Báo cáo khoa học: Mechanistic investigation of a highly active phosphite dehydrogenase mutant and its application for NADPH regeneration pptx
... a standard curve previously prepared from authentic xylitol Each reaction was performed and analyzed at least twice and the reported values are the average of the two measurements with the associated ... concentration and keeping NADP saturated Each assay was carried out at least twice in three separate experiments with the averages and associated standard deviations represented in Fig The data were ... concentrations (labeled or unlabeled) were held at mM and the assay was started by the addition of lg of His6-tagged PTDH in each assay The data was analyzed (Table 2) by tting to the MichaelisMenten...
- 12
- 368
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... primer mC3.F ACAACAATCAGCTGGTTTTCACC mC3.P TGCCAAGCTCCATGGCTCCTATGAAG mC3.R CAAAAAACTCTGTCACCCCTCC mCARP.F CTTGAATCCACAGCCATCCA mCARP.P CATGTCGTGGAGGAAACGCAGATGTC mCARP.R TGGCACTGATTTTGGCTCCT...
- 16
- 462
- 0
Báo cáo hóa học: " Research Article A New Nonlinear Retarded Integral Inequality and Its Application" docx
... Gronwall-like inequality and its applications,” Applied Mathematics and Computation, vol 165, no 3, pp 599–612, 2005 R P Agarwal, Y.-H Kim, and S K Sen, “New retarded integral inequalities with applications,” ... Nonlinear Analysis, vol 64, no 9, pp 2112–2128, 2006 C.-J Chen, W.-S Cheung, and D Zhao, “Gronwall-Bellman-type integral inequalities and applications to BVPs,” Journal of Inequalities and Applications, ... this corollary is obtained immediately by our Theorem 2.1 Journal of Inequalities and Applications Acknowledgments The authors are very grateful to the editor and the referees for their helpful...
- 9
- 313
- 0
Báo cáo khoa học: "A critical review of larch hybridization and its incidence on breeding strategies" potx
... more lowland areas has not been successful in France Several provenance tests have shown its poor adaptation, slow growth, and canker susceptibility (Lacaze and Birot, 1974; Ferrand and Bastien, ... cultivated at lower elevations On the other hand, Japanese larch Larix kaempferi (Lamb.) Carr., an exotic species from Hondo Island, Japan, initially appeared to be a promising successor to European ... rates comparable to other vigorous species such as Douglas fir and an apparent wide soil adaptability on Rational use of the parental populations and their evaluation through hybridization as...
- 13
- 423
- 0
Báo cáo y học: "A human functional protein interaction network and its application to cancer data analysis" potx
... non-Reactome pathway databases Data from four non-Reactome human-curated pathway databases were imported into the Reactome database (28 March 2009 release) These four databases are: Panther [27], ... Ibarrola N, Deshpande N, Shanker K, Shivashankar HN, Rashmi BP, Ramya MA, Zhao Z, Chandrika KN, Padma N, Harsha HC, Yatish AJ, Kavitha MP, Menezes M, Choudhury DR, Suresh S, Ghosh N, Saravana R, Chandran ... Marc Gillespie, Gopal Gopinath, Jill Hemish, Henning Hermjakob, Bijay Jassal, Alex Kanapin, Suzanna Lewis, Shahana Mahajan, Lisa Matthews, Bruce May, Esther Schmidt, and Imre Vastrik The data...
- 23
- 403
- 0
Báo cáo y học: " A multiscale mathematical model of cancer, and its use in analyzing irradiation therapies" ppt
... cycle and are directed to apoptosis They die and disappear from the computational domain after TApoptosis, i.e the duration of the apoptotic phase The standard radiotherapy protocol used in the ... sensitivity to irradiation depends on cell cycle phase and that DNA damage is proportional to the radiation dose Anti-growth regulation signals such as hypoxia and overpopulation activate the SMAD/RAS and ... therefore developed a multiscale mathematical model of these processes to study the efficacy of radiotherapy Several mathematical frameworks have been developed to model avascular and vascular...
- 19
- 315
- 0
A study on bottom spray granulation and its potential applications
... require automated sampling and sample transfer to an automated analyzer Both at-line and off-line techniques involve manual sampling but in the former, the samples are transported locally to an analyzer ... Pharmacy and its administrators for the facility and support during my candidature I also wish to thank A/ P Chan Lai Wah for her concern and advice throughout my candidature Special thanks to Mrs ... interactions has yet to be acquired and much remains to be studied to fully understand them Fluidized bed granulation is an intricate process and the factors affecting the process and granule quality...
- 234
- 335
- 0
A calculus for stochastic qos analysis and its application to conformance study
... provided by a server may also be stochastic For example, due to some contention-based MAC protocols, such as ALOHA and CSMA/CD, the allocated bandwidth to a Ethernet host will be highly aected by the ... is an alternative way to obtain the end -to- end deterministic delay bound, which is to calculate the deterministic delay bound at each node and add together all the delay bounds obtained at each ... This theorem can be used to analyze end -to- end stochastic QoS performance since the output trac of an upstream server can be regarded as the input trac of a downstream server The paper [29] has also...
- 165
- 228
- 0
Gold bioleaching of electronic scrap material by cyanogenic bacteria and its enhancement with biooxidation
... and Castric, 1977; Askeland and Morrison, 1983; Knowles and Bunch, 1986; Kremmer and Souissi, 2001; Faramarzi et al., 2004; Faramarzi and Brandl, 2006; Brandl et al., 2008) They are called cyanogenic ... microorganisms It has been generally believed that cyanide formation has an advantage for the organism by inhibiting competing microorganisms (Blumer and Haas, 2000) In cyanogenic bacteria, cyanide ... with availability and demand (Gasparrini, 1993) Thus, increasing demand and decreasing availability (as discussed above) will lead to higher and higher price of gold in the near future Literature...
- 200
- 188
- 0
Tài liệu AUDIT COMMITTEES COMBINED CODE GUIDANCE: A report and proposed guidance by an FRC-appointed group chaired by Sir Robert Smith docx
... control, financial reporting and risk management; k to review, and challenge where necessary, the actions and judgements of management, in relation to the interim and annual financial statements ... not the audit committee’s, responsibility to prepare complete and accurate financial statements and disclosures in accordance with financial reporting standards and applicable rules and regulations ... by shareholders and the terms and conditions of their appointment Monitoring the relationship with the external auditor and the company and its executive management, in particular safeguard auditor...
- 52
- 307
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25