Substitution of square planar complexes
Substitution of square planar complexes
... conditions of excess incoming ligand • We’ll look briefly at rate laws (details in text), consider primarily octahedral complexes Substitution Mechanisms Substitution Mechanisms Pictures: Substitution ... octahedral d3, low spin d4 - d6, strong field d8 square planar – Intermediate: weak field d8 – Labile: d1, d2, high spin d4 - d6, d7, d9, d10 Substitution Mechanisms • Two extremes: Dissociative ... regardless of [Y] •Very few examples known with detectable intermediate Factors affecting rate • Most octahedral reactions have dissociative character, square pyramid intermediate • Oxidation state of...
- 34
- 1,343
- 0
Tài liệu Báo cáo khoa học: Structure of RNase Sa2 complexes with mononucleotides – new aspects of catalytic reaction and substrate recognition pptx
... for some of the differences observed in substrate recognition and RNA cleavage between RNases Sa2 and Sa 2¢-GMP in the active site of RNase Sa2 To obtain a set of complexes of RNase Sa2 with the ... understand the mechanism of RNA cleavage and differences in the catalytic properties of the two RNases, we have solved the structures of RNase Sa2 with a free active site, and in complexes with ... antiparallel b-strands (residues 7–9 , 5 4–5 9, 7 0–7 5, 8 0–8 3, and 9 1–9 4) (Fig 1) The antiparallel b-sheet, which contains three strands (residues 5 4–5 8, 7 1–7 4, and 7 9–8 3), forms the hydrophobic core of the...
- 13
- 523
- 0
Tài liệu Báo cáo khoa học: A single amino acid substitution of Leu130Ile in snake DNases I contributes to the acquisition of thermal stability A clue to the molecular evolutionary mechanism from cold-blooded to warm-blooded vertebrates docx
... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding ... factor in the initiation of human and rat SLE [12,40], the acquisition of thermally stable characteristics during DNase I evolution may provide a clue to the etiology of SLE in humans and mice,...
- 8
- 500
- 0
Báo cáo khoa học: Reactions of gold(III) complexes with serum albumin docx
... present paper, we have tried to detail the reactions of a series of emerging antitumour gold(III) complexes of appreciable redox stability with serum albumin, used as a general model for globular ... interactions of some well known anticancer ruthenium(III) complexes and of auranofin with plasma proteins [19–21] Very scarce information exists on the reaction of gold(III) complexes with proteins ... treatment of these derivatives with lower amounts of cyanide did not result in complete detachment of gold from the protein Ó FEBS 2003 Interactions of cytotoxic gold(III) complexes with BSA...
- 7
- 389
- 0
Báo cáo khoa học: Cholecystokinin rapidly stimulates CrkII function in vivo in rat pancreatic acini Formation of CrkII–protein complexes docx
... formation of CrkII protein complexes in rat pancreatic acini Thus, in the present work, we investigated whether in vivo activation of the CCKA receptor regulates CrkII function to form protein complexes ... Fig Phosphotyrosine dependence of the CCK-8 induction of CrkII electrophoretic mobility shift in pancreatic acini Rat pancreatic acini preincubated for h with the tyrosine kinase inhibitor, B44 ... 7–9) Discussion In this study, we have demonstrated that CCK rapidly promotes the formation of CrkII protein complexes, CrkII paxillin and CrkII p130Cas, in rat pancreatic acini Recently, it...
- 8
- 256
- 0
SUBSTITUTION OF HAZARDOUS CHEMICALS IN PRODUCTS AND PROCESSES potx
... chemicals in a variety of products and processes, serving a range of functionalities including cleaning operations (metal parts, facades, textiles), coating / painting / inking operations (marine anti-foulings, ... SUBSTITUTION OF HAZARDOUS CHEMICALS IN PRODUCTS AND PROCESSES • FINAL REPORT The authorities take the initiative and launch various kinds of support programs in certain sectors of industry or ... contamination of waste, • Prevention of exposure of workers to certain hazardous substances and 18 Kooperationsstelle Hamburg SUBSTITUTION OF HAZARDOUS CHEMICALS IN PRODUCTS AND PROCESSES • FINAL...
- 120
- 265
- 0
Báo cáo khoa học: Calpain involvement in the remodeling of cytoskeletal anchorage complexes potx
... a-actinin and c-filamin, are able to bind calpain with increasing affinity in the presence of calcium [32,39,69] Specific binding sites have been identified in the C-terminal EF-hand part of a-actinin ... kDa, corresponding to the head of the molecule The cleavage separates the talin N-terminal from the C- terminal domains and unmasks the integrin-binding site In vivo proteolysis inhibited by ALLN; ... phosphorylation of the filamin C-terminus domain by protein kinase C (PKC) a protected c-filamin against proteolysis by calpain in COS cells They further illustrated their idea using myotubes, showing that the...
- 12
- 432
- 0
Báo cáo khoa học: Deoxyribonuclease I footprinting reveals different DNA binding modes of bifunctional platinum complexes potx
... characterize the DNA binding of a number of small molecules of biological significance [1,6–15], including antitumor cis-diamminedichloroplatinum(II) (cisplatin) (Fig 1B) and its clinically ineffective ... formation, identification, and quantitation Biochemistry 24, 707–713 32 Anin MF & Leng M (1990) Distortions induced in double-stranded oligonucleotides by the binding of cis-diamminedichloroplatinum(II) ... DNA interstrand cross-links of cis-diamminedichloroplatinum(II) and its trans isomer by DNA- binding proteins Biochemistry 34, 12379–12387 Lemaire MA, Schwartz A, Rahmouni AR & Leng M (1991) Interstrand...
- 12
- 208
- 0
THE SUMS OF SQUARE TECHNIQUE
... again, we can get the result J Now, I will present another proof of mine based on this theorem y x z y Since a, b, c > 0, abc = 1, there exists x, y , z > such that a = , b = , c = x then our inequality ... = 1, then 1 + + ≥ a + a +1 b + b +1 c + c +1 a = Proof From the given condition a, b, c > 0, abc = , there exist x, y , z > such that b = c = yz x2 zx And y2 xy z2 then, the inequality ... > Then the inequality is proved J Example (V ình Quý) Let a, b, c > 0, abc = Prove that 1 + + ≤ a − a +1 b − b +1 c − c +1 Solution On Mathlinks inequality forum, I posted the following proof:...
- 5
- 202
- 2
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt
... Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses ArticleCategory : Research Article ArticleHistory ... characterization of new swine-origin H1N1 influenza viruses Nature 2009, 460:1021–1025 Kashiwagi T, Hara K, Nakazono Y, Hamada N, Watanabe H: Artificial hybrids of influenza A virus RNA polymerase reveal PA ... March-May, 2009 MMWR Morb Mortal Wkly Rep, 58:585– 589 Itoh Y, Shinya K, Kiso M, Watanabe T, Sakoda Y, Hatta M, Muramoto Y, Tamura D, SakaiTagawa Y, Noda T et al.: In vitro and in vivo characterization...
- 15
- 237
- 0
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can catalyze cRNA ... ratios of cRNA to mRNA and vRNA to mRNA changed by around fold across the temperature range When a cRNA-like CAT RNA was transfected the cRNA:mRNA ratio decreased by over 3-fold and the vRNA:mRNA...
- 16
- 313
- 0
Báo cáo toán học: "Bijective census and random generation of Eulerian planar maps with prescribed vertex degrees" pptx
... function E(u, v) of balanced Eulerian trees with respect to number of positive and negative signs and the generating function M (u, v) of Eulerian maps with respect to number of vertices and faces satisfy: ... belong to any suiting balanced Eulerian tree of M Cut e0 and e1 , delete the end of e0 and start of e1 and close with a root edge the start of e0 with the end of e1 The map which is obtained ... electronic journal of combinatorics (1997), #R20 11 Random generation algorithms We consider first the problem of uniform generation of Eulerian maps whose vertex degrees lie in a finite set D of even numbers...
- 14
- 311
- 0
Báo cáo toán học: "New infinite families of almost-planar crossing-critical graphs" ppsx
... communication and preprint of [2]) that typical constructions of infinite families of simple 3-connected k -crossing-critical graphs create bounded numbers (wrt k) of vertices of degrees other than ... in infinite families of k -crossing-critical graphs? We positively answer one half of his question in Theorem 3.1 and Proposition 2.1; • namely we construct, for all k > 2, infinite families of ... 332–341 [11] G Salazar, Infinite families of crossing-critical graphs with given average degree, Discrete Math 271 (2003), 343–350 ˇ aˇ [12] J Sir´n, Infinite families of crossing-critical graphs...
- 12
- 217
- 0
Báo cáo khoa học: " Effect of multi-planar CT image reformatting on surgeon diagnostic performance for localizing thoracolumbar disc extrusions in dogs" docx
... reviewed for 111 dogs with confirmed thoracolumbar disc extrusions in order to test the effects of MPR CT images on surgeon diagnostic performance Surgeon diagnostic performance was assessed using ... assessment of canine IVDD The purpose of this study was to test the effects of MPR CT on surgeon diagnostic performance in a group of dogs with confirmed thoracolumbar intervertebral disc extrusions ... images Image post-processing (reformatting) software can be used to convert a set of 2D CT slice images into a set of volume data for interactive manipulation and visualization [5] Reformatting software...
- 8
- 328
- 0
Từ khóa: electrophilic aromatic substitution of heteroaromatic compoundsinstallations equipment or machines in substitution of other similar parts including spare parts that are stored for less than one year1 full substitution of stability bond issuance for national issuance with joint and several guarantees2 partial substitution of national issuance with stability bond issuance with joint and several guarantees3 partial substitution of national issuance with stability bond issuance with several but not joint guaranteapplications of calorimetric techniques in the formation of protein polyelectrolytes complexesthe role of multiple sequence repeat motifs in the assembly of multi protein complexesstructural studies of the functional complexes of the 50s and 70s ribosome a major antibiotic targetstructural dynamics of picornaviral rdrp complexes implications for the design of antiviralsthe number of players and the replacement and substitution of playerssubstitution of h vs ipso substitutiondesign of square and rectangular platformsuse of electron microscopy for analysis of large macromolecular complexesswi snf family of chromatin remodeling complexesstructural characterization of drug dna complexesNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015MÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ