Cách lấy mẫu bệnh phẩm EV 71

Cách lấy mẫu bệnh phẩm EV 71

Cách lấy mẫu bệnh phẩm EV 71
... •Bỏ MTVC vào phíc lạnh or hộp đá vận chuyển đến khoa Vi Sinh Lợi: Chính tác nhân gây bệnh Tỷ lệ dương tính cao Cách làm - Lau vùng da chỗ có bóng nước nước cất hay nước muối sl, cồn chất tiệt khuẩn ... Bỏ vào phíc lạnh or hộp đá vận chuyển đến khoa Vs 10 Dòch não tủy Cách làm -Trong điều kiện vô trùng, bác só có kinh nghiệm, lấy ml x tube (3 tube cho XN: vi sinh miễn dòch tế bào, sinh hoá, ... Dòch bóng nước Lợi: -Tỷ lệ dương tính cao -Có giá trò cho tất bênh nhân -Ko yêu cầu diện niêm mạc Cách làm •Dùng que tẩm nhẹ NMSL vô trùng cho vào trực tràng vừa qua khỏi vòng hậu môn, vừa xoay...
  • 2
  • 29
  • 0


... xét nghiệm điện giải, chất chống đơng thường dùng Heparin: A Đúng B Sai Khi lấy nước tiểu để xét nghiệm, cần lưu ý: A Lấy nước tiểu 24 để làm xét nghiệm định tính B Lấy nước tiểu cho xét nghiệm ... bảo quản bệnh phẩm: D – 10°C E – 20°C A Nhiệt độ bảo quản B Thời gian bảo quản C Chất bảo quản D Điều kiện làm nóng lại bệnh phẩm tới nhiệt độ làm phản ứng E Tất câu Khi vận chuyển bệnh phẩm, phải ... Ion sau có vai trò chống tiêu đường, sử dụng xét nghiệm định lượng glucose máu: A Na+ B K+ C F- D Cl- E Ca++ 12 Alcol thường dùng để sát khuẩn lấy máu alcol 90o A Đúng B Sai 13 Khi định lượng...
  • 7
  • 925
  • 16

Cách lấy mẫu bệnh phẩm EV71

Cách lấy mẫu bệnh phẩm EV71
... BP -Kỹ thuật dùng xét nghiệm HOW MANY / MUCH -Số bệnh nhân cần lấy BP -Số bệnh phẩm cần lấy BN -Khối lượng/thể tích mẫu BP TRANG BỊ LẤY BỆNH PHẨM -Phiếu yêu cầu XN -Bút bi, bút dầu không phai ... cần lấy bệnh phẩm (BP) -Người có trách nhiệm lấy chuyển BP -Người có trách nhiệm xét nghiệm, trả lời kết WHAT -Loại BP ? -Trang bò ? Dụng cụ, hoá chất … WHEN -Thời điểm lấy BP HOW -Cách lấy, ... đích •Vật liệu dùng để lấy giữ mẫu thử: phải quan tâm (các NA đích có mẫu bò phân hủy hay mẫu thử chứa chất ức chế FUKĐ)=>tinh mặt SH: Ko nhiễm Pro •BQ BQ v chuyên chở mẫu: nguyên trạng, NA tác...
  • 6
  • 25
  • 0

Quy chuẩn kỹ thuật quốc gia về bệnh động vật yêu cầu chung lấy mẫu bệnh phẩm, bảo quản và vận chuyển

Quy chuẩn kỹ thuật quốc gia về bệnh động vật  yêu cầu chung lấy mẫu bệnh phẩm, bảo quản và vận chuyển
... nghiệp Phát triển Nông thôn QCVN 01-83:2011/ BNNPTNT QUY CHUẨN KỸ THUẬT QUỐC GIA BỆNH ĐỘNG VẬT – YÊU CẦU CHUNG LẤY MẪU BỆNH PHẨM, BẢO QUẢN VÀ VẬN CHUYỂN National technical regulation on Animal diseases ... lấy mẫu Nếu gửi xét nghiệm, bảo quản vận chuyển theo mục 1.8.3 quy chuẩn Mẫu xét nghiệm biến đổi vi thể: Bảo quản vận chuyển theo mục 1.8.4 quy chuẩn II QUY ĐỊNH VỀ KỸ THUẬT 2.1 Lấy mẫu ... 1.2 Đối tượng áp dụng Quy chuẩn quy định quy trình lấy mẫu bệnh phẩm, bảo quản vận chuyển 1.3 Thuật ngữ định nghĩa Trong quy chuẩn này, từ ngữ hiểu sau: 1.3.1 Mẫu bệnh phẩm: mẫu nguyên quan, tổ...
  • 19
  • 227
  • 0

Mẫu sổ tay lấy mẫu bệnh phẩm

Mẫu sổ tay lấy mẫu bệnh phẩm
... trị bệnh nhân nội trú phòng xét nghiệm thực lấy mẫu bệnh phẩm cho bệnh nhân Trách nhiệm Tất nhân viên giao nhiệm vu lấy mẫu chuyển mẫu đến phòng xét nghiệm có trách nhiệm hiểu tuân thủ sổ tay ... xét nghiệm: Loại xét nghiệm, loại mẫu, chẩn đoán lâm sàng 4.3 Lấy mẫu bệnh phẩm - Ghi ngày lấy mẫu, mã số họ tên, tuổi, giới tính bệnh nhân nhãn ống đựng mẫu bệnh phẩm - Tuân thủ quy trình kỹ thuật ... lẫy mẫu bệnh phẩm nhằm đảm bảo mẫu bệnh phẩm đạt yêu cầu kết xét nghiệm xác đáng tin cậy Phạm vi áp dụng 7 17 BỆNH VIỆN ĐẠI HỌC Y DƯỢC HẢI PHÒNG Sổ tay lấy mẫu bệnh phẩm - Phi Phòng Quản Lý Chất...
  • 8
  • 1,206
  • 16

Hệ thống quản lý mẫu bệnh phẩm trên gia súc, gia cầm

Hệ thống quản lý mẫu bệnh phẩm trên gia súc, gia cầm
... để quản thông tin chẩn đoán, xét nghiệm cách tốt đem lại hiệu cao Đó xây dựng Hệ thống phần mềm Quản thông tin chẩn đoán cho Cục Thú Ý: Phần mềm Hệ thống quản mẫu bệnh phẩm gia súc, gia ... thông tin cần quản - Phiếu gửi bệnh phẩm: mẫu phiếu ghi nhận thông tin bệnh phẩm gửi đến để yêu cầu xét nghiệm chẩn đoán Tất thông tin phiếu gửi bệnh phẩm (gia cầm gia súc) phải quản sở liệu ... Phiếu bệnh phẩm nội bộ: mẫu phiếu yêu cầu xét nghiệm gửi cho phòng xét nghiệm chuyên môn sau bệnh phẩm mổ khám kiểm tra bệnh tích (phân loại) Tất thông tin phiếu bệnh phẩm nội (gia cầm gia súc)...
  • 9
  • 291
  • 5

Hệ thống quản lý mẫu bệnh phẩm trên gia súc , gia cầm

Hệ thống quản lý mẫu bệnh phẩm trên gia súc , gia cầm
... gửi bệnh phẩm Địa chỉ/Số ĐT/Fax Họ tên chủ gia cầm nơi lấy mẫu, Địa Lồi gia cầm, Lứa tuổi, Giống, Giới tính Loại bệnh phẩm, Số lượng Ngày lấy mẫu Tình trạng bệnh phẩm 1.Diễn biến Ngày bị bệnh, ... cúm gia cầm + Cập nhật ngày 31/10/200 7, dịch cúm gia cầm Cao Bằng, Quảng Tr , Nam Định, Hà Nội, Hải Dương,.v.v + Ngày 04/04/200 8, dịch bệnh “tai xanh” heo, bệnh lở mồm long móng gia súc Dịch bệnh ... lại cho người sử dụng, Trung tâm/Cơ sở cách chẩn đốn xét nghiệm mẫu bệnh phẩm gia súc, gia cầm xác, nhanh, dễ sử dụng, cách quản khoa học, dễ phát bệnh, sát thực với thực t , đặc biệt phù hợp...
  • 22
  • 212
  • 1

Hệ thống quản lý mẫu bệnh phẩm gia súc, gia cầm

Hệ thống quản lý mẫu bệnh phẩm gia súc, gia cầm
... ứng Hỗ trợ hệ thống P Bệnh ký sinh trùng Đầu Mẫu bệnh phẩm kiểm tra Nhập thơng tin mẫu bệnh phẩm tương ứng vào hệ thống Các thơng tin cần phải ghi nhận lại : Số bệnh phẩm (Tự sinh hệ thống) Họ ... cơng Hỗ trợ hệ thống PL003 Báo cáo Hỗ trợ phiếu hệ Bệnh thống phẩm nội Đầu nghiệp vụ PL001 Đánh giá mẫu bệnh phẩm PL002 Gửi mẫu tới P.Xét nghiệm Xử P .Bệnh – Ký sinh trùng P .Bệnh – Ký sinh ... nhận mẫu bệnh Phiếu gửi bệnh phẩm Dữ liệu Bệnh & Ký sinh trùng phẩm từ nơi gửi đến Phiếu bệnh phẩm nội cơng ty - Kiểm tra mẫu bệnh Phiếu trả lời kết xét nghiệm phẩm - Ghi nhận mẫu bệnh phẩm...
  • 22
  • 164
  • 0


... nghim vi sinh: I Vi Sinh Thc Phm (V sinh an ton thc phm) QUY TRèNH V PHNG PHP LY MU THC PHM XẫT NGHIM VI SINH (Ly mu giũ ch, bỳn, tht heo quay, ) 1) Mc ớch ca vic ly mu thc phm kim nghim vi sinh ... XẫT NGHIM VIRUT VI M GAN B nh ngha: Vi rỳt gõy vi m gan l nhng vi rỳt cú ỏi tớnh vi t bo gan, õy l t bo ớch m vi rỳt xõm nhp, nhõn lờn v gõy tn thng Tuy cú cựng t bo ớch, nhng cỏc vi rỳt vi m gan ... Kho Yêu cầu xét nghiệm Kết xét nghiệm - HBsAg (Vi m gan B) âm tính Hà Tĩnh, ngày Phụ trách khoa XN Ho va tờn: Vừ Th Qunh Hng 21 tháng 06 năm 2012 Cán xét nghiệm Lp: A25 - 28 Báo cáo thực tập tốt...
  • 74
  • 1,833
  • 0

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction

Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46-69 54.6 DiagH5R GACCAAGAACTTTTGGGGATG 416-396 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503-524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... Influenza, 12th edn Ames, IA: Blackwell Publishing Professional 46 Takano R, Nidom CA, Kiso M, Muramoto Y, Yamada S, Sakai-Tagawa Y, Macken C, Kawaoka Y (2009), “Phylogenetic characterization of H5N1 ... H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential”, Avian Diseases, 40: 425437 45 Swayne DE and Halverson DA (2007), Diseases...
  • 11
  • 222
  • 0


... nghim vi sinh: I Vi Sinh Thc Phm (V sinh an ton thc phm) QUY TRèNH V PHNG PHP LY MU THC PHM XẫT NGHIM VI SINH (Ly mu giũ ch, bỳn, tht heo quay, ) 1) Mc ớch ca vic ly mu thc phm kim nghim vi sinh ... XẫT NGHIM VIRUT VI M GAN B nh ngha: Vi rỳt gõy vi m gan l nhng vi rỳt cú ỏi tớnh vi t bo gan, õy l t bo ớch m vi rỳt xõm nhp, nhõn lờn v gõy tn thng Tuy cú cựng t bo ớch, nhng cỏc vi rỳt vi m gan ... cầu xét nghiệm Ho va tờn: Vừ Th Qunh Hng Kết xét nghiệm Lp: A25 - 28 Báo cáo thực tập tốt nghiệp âm tính - HBsAg (Vi m gan B) Hà Tĩnh, ngày Phụ trách khoa XN 21 tháng 06 năm 2012 Cán xét nghiệm...
  • 75
  • 1,967
  • 1

Quá trình lấy mẫu (Bệnh viện MEDLATEC) docx

Quá trình lấy mẫu (Bệnh viện MEDLATEC) docx
... (glycolysis) khoảng 7% nên cần phải thêm chất ức chế trình đường phân NaF (sodium fluorid) iodoacetat vào mẫu máu trước xác định nồng độ glucose máu Cách lấy máu để xét nghiệm huyết học: phần lớn phân ... với heparin Cách lấy máu toàn phần: máu toàn phần thu cách sử dụng chất chống đông nêu (không ly tâm) Một số xét nghiệm đòi hỏi sử dụng chất chống đông khác nhau, chẳng hạn: Cách lấy máu để định ... đông máu, chất gây nên bất hoạt nhanh chóng yếu tố V yếu tố VIII Phải loại bỏ mẫu máu bị tan huyết bắt đầu đông máu Cách lấy nước tiểu Khi phân tích nước tiểu cần phải ý có khác rõ rệt ngày tiết...
  • 6
  • 144
  • 0

Nghiên cứu khoa học: Hệ thống quản lý mẫu bệnh phẩm trên gia súc, gia cầm ppt

Nghiên cứu khoa học: Hệ thống quản lý mẫu bệnh phẩm trên gia súc, gia cầm ppt
... viên nghiên cứu khoa học 2008 CÔNG TRÌNH DỰ THI SINH VIÊN NGHIÊN CỨU KHOA HỌC NĂM 2008 Đề tài: Hệ thống quản mẫu bệnh phẩm gia súc, gia cầm I Mở đầu chọn đề tài: Trong năm qua dịch bệnh gia ... dung nghiên cứu Nội dung nghiên cứu dựa mẫu bệnh phẩm gia súc, gia cầm để chẩn đoán xét nghiệm triệu chứng, bệnh tích bệnh, gửi kết lên Trung tâm Chẩn đoán thú y Phương pháp nghiên cứu Nghiên cứu ... tin mẫu bệnh phẩm tương ứng Hỗ trợ hệ thống P Bệnh ký sinh trùng Đầu Mẫu bệnh phẩm kiểm tra Nhập thông tin mẫu bệnh phẩm tương ứng vào hệ thống Các thông tin cần phải ghi nhận lại : Số bệnh phẩm...
  • 23
  • 134
  • 0

Xem thêm

Từ khóa: cách lấy mẫu thực phẩmkỹ thuật lấy mẫu bệnh phẩmbộ dụng cụ lấy mẫu bệnh phẩmquy trình lấy mẫu bệnh phẩmphương pháp lấy mẫu bệnh phẩmchẩn đoán tác nhân vsv lấy và vận chuyển mẫu bệnh phẩmyêu cầu kỹ thuật lấy mẫu thực phẩm bệnh phẩm khi xảy ra nđtpmẫu bệnh phẩmquản lý mẫu bệnh phẩmcách lấy mẫu thí nghiệmquy trình lấy mẫu thực phẩmquy cách lấy mẫu thép thí nghiệmcách lấy mẫu đất thí nghiệmquy cách lấy mẫu thí nghiệmcách lấy mẫu thí nghiệm thépCông Nghệ Sản Xuất Ắc Quy Chì Acid Kín KhíKỹ thuật lạnh thực phẩm TS Nguyễn Xuân PhươngThiết kế trạm biến áp 22011022 KV theo nhu cầu của phụ tảiThiết kế vi mạch CMOS VLSI Tập 2Metric and topology spaces chương 3Xây dựng ứng dụng streaming video từ serverXây dựng website bán hàng cho cửa hàng máy tính minh quangSự xấp xỉ holder cho hàm nguồn của một phương trình nhiệt ngược thời gianXây dựng một số giải pháp bảo mật cho hệ thống mạng trường đh CNTTTT sử dụng microsoft forefront TMG 2010Xây dựng phần mềm quản lý bán hàng cho doanh nghiệp tư nhân kim khí quang naXây dựng website hỗ trợ học tiếng anh trực tuyến cho trường tiểu học thị trấn yên lập – phú thọKhảo sát ảnh hưởng của sự chuyển động của các node mạng đến hiệu suất của một số giao thức định tuyến trong mạng MANETỨng dụng mô hình điều khiển mạng SDN trong thiết kế mạng cho công ty TNHH thương mại dịch vụ quốc tế hoàng giaXây dựng chương trình quản lý nhân sự cho tiểu đoàn 5 – học viện phòng không – không quân – hà nộiThiết kế mạch đồng hồ số sử dụng vi điều khiển AT89C51Xây dựng ứng dụng hỗ trợ luyện thi GRE cho sinh viên ICTU trên nền tảng androidNghiên cứu xây dựng chương trình quản trị quan hệ khách hàng cho công ty cổ phần công nghệ DKT tại hà nộiTrang bị điện và truyền thông trong mô hình hệ thống hồi lưu nước nóng dân dụngĐiều khiển hệ thống trộn polymer sử dụng PLC trong nhà máy sản xuất núi pháode thi thu vao lop 10 mon ngu van truong thcs tien tien
Nạp tiền Tải lên
Đăng ký
Đăng nhập