0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Ngữ pháp tiếng Anh >

Formation of a complex sentence with an adjective clause

Báo cáo y học:

Báo cáo y học: " Pelvo-ureteric junction obstruction in the lower pole moiety of a duplex kidney with an associated intraparenchymal abscess: a case report" pot

... authors have read and approved the final manuscript Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written ... resonance imaging scan with fat saturation and gadolinium enhancement The cortical mass is seen as a low signal with an enhancing rim (arrows) Figure (arrow) to shows with obstruction junction3 of ... enhancing capsular rim On the MR appearances, the differential diagnosis was either a tumour or an abscess Given that the patient was septic, this cystic lesion with an enhancing capsule was...
  • 3
  • 306
  • 0
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

... coastal-zone management, integrated river basin management and/or ecosystem-based river basin management (Nakamura, 2003) Embedded in these approaches are the concepts of participatory management and adaptive ... and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and Quade (1985), systems analysis is interchangeably ... concerns into governance Environmental values 3) Vertically integrated planning and management Tiers of governance 4) Integration across environmental media Water, land and air 5) Integrated environmental...
  • 139
  • 492
  • 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that finally ... context of macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading to the maturation of the cytochrome bc1 complex in the inner mitochondrial...
  • 15
  • 639
  • 0
Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

Báo cáo khoa học: Unconventional translation initiation of human trypsinogen 4 at a CUG codon with an N-terminal leucine A possible means to regulate gene expression pdf

... (20 04) Unanticipated antigens: translation initiation at CUG with leucine PLoS Biol 2, e366 15 Kozak M (1986) Point mutations dene a sequence anking the AUG initiator codon that modulates translation ... an N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a great impact on the analysis of genes ... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an...
  • 11
  • 469
  • 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

... GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... form any additional contacts with the molecule A 2164 Catalytic site The catalytic reaction of glucoamylases proceeds with inversion of configuration at the anomeric carbon which requires a pair of ... H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢);...
  • 11
  • 548
  • 0
A MODEL OF NUTRITION INFORMATION SEARCH WITH AN

A MODEL OF NUTRITION INFORMATION SEARCH WITH AN

... Grossman’s model of the demand for health, health is a capital good produced via time and money and thus determines the amount of time available for market and non-market activities and the amount ... A MODEL OF NUTRITION INFORMATION SEARCH WITH AN APPLICATION TO FOOD LABELS Abstract Due to the dramatic rise of several diet-related chronic diseases, nutrition information search behaviours ... theoretical economic model of nutritional information search and acquisition, although the empirical mechanisms of nutritional information search have been addressed in the book edited by Chern and...
  • 25
  • 301
  • 0
báo cáo hóa học:

báo cáo hóa học: "Design of a complex virtual reality simulation to train finger motion for persons with hemiparesis: a proof of concept study" docx

... devices to accommodate patients with different levels of impairments, 3) provides unilateral and bilateral training and 4) combines training of the hand and arm into an integrated task-based simulation ... unilaterally or bilaterally and combine proximal and distal training into a single activity or train each segment separately Additionally, it presents information regarding the variability among ... Piano Trainer, a complex simulation, intended to train individual finger motion that provides realistic auditory and visual feedback of appropriate piano notes, sounds and music and combines hand...
  • 10
  • 506
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Choosing simplified mixed models for simulations when data have a complex hierarchical organization. An example with some basic properties in Sessile oak wood (Quercus petraea Liebl.)" ppsx

... are of particular importance for forest managers and forest policy-makers In these multiple regards, it seems important to maintain a sufficient degree of genetic variability in oak stands, in ... colour, spiral grain, multiseriate wood rays) on both standard small-size samples and industrial-size boards Our data have a hierarchical organization Each level of the hierarchy could be a level ... climates: north of Alsace (sandstone hills and sandy-loamy soils in the plain), Plateau lorrain, Val de Loire, Basse-Normandie, Allier-Bourbonnais (Center of France) In each region, a large range...
  • 9
  • 304
  • 0
Báo cáo y học:

Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx

... (Rheumaklinik Aachen, Aachen, Germany), Prof Dr MJ Fritzler (University of Calgary, Calgary, Canada) and by Labor Limbach (Heidelberg, Germany) To assess further the assay specificity, we analyzed ... studies are necessary to screen known autoantigens containing dimethylated arginine residues for epitopes assay Assay performance characteristics of the anti -SmD3 peptide (SMP) assay (a) Intra-assay ... Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation in percentage...
  • 11
  • 593
  • 0
A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot

A novel family of P-loop NTPases with an unusual phyletic distribution and transmembrane segments inserted within the NTPase domain pot

... distantly related to the AAA+ and AP/NACHT NTPases [10,11,13] All eukaryotic and several bacterial members of the KAP family contain two or four transmembrane segments inserted into the P-loop NTPase ... [10] The ASCE division includes AAA+, ABC, PilT, superfamily 1/2 (SF1/2) helicases, and RecA/F1/F0 classes of ATPases, and a large assemblage of NTPases related to the AP(apoptotic) and NACHT families ... of the KAP family have a variable α-helical insert amino-terminal to the Walker B motif Remarkably, all animal KAP NTPases and three bacterial ones, those from Anabaena, G sulfurreducens and...
  • 10
  • 275
  • 0

Xem thêm

Từ khóa: 10  controlling the direction and speed of a brushed motor with an h bridgethe realization of a type associated with an essencecomplete of the following sentence with an appropriate present participle of the verb from the boxthe new bdsf method of positioning the implant as a simple beam with an overhanging endthe adaptation of a machinelearned sentencehow to connect to a wireless router with an ethernet cablestate space of a complex systemdiscuss the role of a security manager in an organizationanalyse the importance of a secondary sector in an economythe standard form of a complex number islength of a complex vectormonte carlo simulation using excel spreadsheet for predicting reliability of a complex systemexample of a situation dealing with a difficult customer414 algebraic analysis of a logic circuit with nand and nor gatesuse three points to indicate ellipsis at the beginning or in the middle of a quoted sentenceMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ