Vi rus cum a h7n9 2

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm Avi rút hợp bào hô hấp ở Việt Nam

Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phương pháp chẩn đoán sớm, phác đồ điều trị hiệu quả và dự phòng bệnh viêm đường hô hấp cấp do vi rút cúm A1H1N1, vi rút cúm A và vi rút hợp bào hô hấp ở Việt Nam
... Nớc Nghiên cứu đặc điểm lâm sàng, dịch tễ học, phơng pháp chẩn đoán sớm, phác đồ điều trị hiệu dự phòng bệnh vi m đờng hấp cấp vi rút H5N1, vi rút cúm A vi rút hợp bào hấp Vi t Nam Đề tài ... biện pháp phòng chống bệnh vi m đờng hấp cấp vi rút cúm H5N1, vi rút cúm A vi rút hợp bào hấp Phần A: Vi m đờng hấp cấp vi rút cúm a v vi rút cúm a/ h5n1 Chơng Tổng quan 1.1 Khái niệm cúm ... PCR (bp) mồi NP_F NP_R 69 ggaattcatggcgtctcaaggcaccaaa 71 tcccccgggtcaattgtcatattcctctgc N1_F GGAATTCATGAATCCAAATCAGAAGATAATAACCATT N1_R TCCCCCGGGCTACTTGTCAATGGTGAAT 1573 Thành phần phản ứng...
  • 272
  • 351
  • 2

Tính kháng thuốc Oseltamivir của vi rút cúm A lưu hành tại miền Bắc Việt Nam, 2001 – 2012 (tóm tắt)

Tính kháng thuốc Oseltamivir của vi rút cúm A lưu hành tại miền Bắc Việt Nam, 2001 – 2012 (tóm tắt)
... A/ Vietnam/TX200/08 A/ Vietnam/TX233/08 A/ Vietnam/BT241/08 A/ Vietnam/LS324/08 A/ Vietnam/32036/09 A/ Vietnam/EL197/09 A/ Vietnam/Q271/09 A/ Vietnam/31808/09 A/ Vietnam/34381/09 A/ Vietnam/N116/09 A/ Mississippi/03 /2001 ... tiến h a vi rút cúm A Vi t Nam Nghiên cứu tính kháng thuốc oseltamivir vi rút cúm theo chiều dọc thời gian từ 2001- 2012 với số liệu thu thập sở liệu tương tác vi rút cúm với oseltamivir Vi t Nam ... 1422 A/ Vietnam/32060/09 1072 2009 GMĐNCc a vi rút với A/ Vietnam/32067/09 2944 oseltamivir A/ Vietnam/33419/09 417 2011 A/ Vietnam/36530/11 356 Vi rút A/ H5N1 A/ Vietnam/HN30408 GMĐNCc a vi rút với...
  • 24
  • 89
  • 0

Tính kháng thuốc Oseltamivir của vi rút cúm A lưu hành tại miền Bắc Việt Nam, 2001 – 2012

Tính kháng thuốc Oseltamivir của vi rút cúm A lưu hành tại miền Bắc Việt Nam, 2001 – 2012
... trình tự phân đoạn gen mã h a NA Hướng Mồi Trình tự Ba-NA-1F AGCGAAAGCAGGAGT Ba-NA-1413R AGTAGAAACAAGGAGTTTTTT N1-780F GGGGAAGATTGTYAAATCAGTYGA N1-1273R CWACCCAGAARCAAGGYCTTATG Xuôi Ngược Xuôi Ngược ... h a HA Phân típ cúm Mồi Trình tự H5-3F H1HA H5-R1 GAC AGT ATT TGG TAA ATT CC H5-5R GGA CTC AAG AAT TAT GAA AAG TG H5-3R H5HA CTC GGA AAC CCA ATG TGT GAC CTC CCC TGC TCA TTG CTA TG Bm-HA-1F AGCGAAAGCAGGGG ... NA chủng cúm A liên quan đến kháng thuốc oseltamivir 65 3.5 Tỉ lệ chủng vi rút cúm A kháng oseltamivir miền Bắc Vi t Nam, 2001- 2012 69 3.6 Sự tương đồng gen HA NA vi rút...
  • 139
  • 171
  • 0

Nghiên cứu một số đặc tính sinh học của vi rút cúm a/h5n1 clade phân lập ở việt nam

Nghiên cứu một số đặc tính sinh học của vi rút cúm a/h5n1 clade phân lập ở việt nam
... 1996-2001, vi rỳt cỳm gia c m ủ c l c cao A/H5N1 ch y u ch lu hnh phớa Nam Trung Qu c Giai ủo n ny ghi nh n cú clade vi rỳt A/H5N1 khỏc l clade 0, clade 3, clade v clade 9, ủú clade l vi rỳt thu ... cng ủó phỏt hi n ủ c nhi u ch ng vi rỳt A/H5N1 khỏc ủ c phõn lo i vo cỏc nhỏnh (clade) khỏc nh: clade 1, clade 3, clade 2.3.4, clade, clade, clade 7(C c Thỳ y, 2013) Qua theo ... 2.3.2 (2005); clade 2.3.4 (2007) Vi rỳt cỳm A/H5N1 thu c clade ủ c phõn l p biờn gi i phớa B c v m t s ch gia c m s ng phớa B c Vi t Nam (Nguy n Tựng v cs, 2011) Vi rỳt A/H5N1 thu c clade 2.3.2...
  • 83
  • 181
  • 0

Một số đặc điểm vi rút học của vi rút cúm A/H1N1/09 đại dịch tại Việt Nam, 2009 - 2013

Một số đặc điểm vi rút học của vi rút cúm A/H1N1/09 đại dịch tại Việt Nam, 2009 - 2013
... VI N VỆ SINH DỊCH TỄ TRUNG ƢƠNG -  - NGUYỄN THỊ KIM PHƢƠNG MỘT SỐ ĐẶC ĐIỂM VI RÚT HỌC CỦA VI RÚT CÚM A/H1N1/09 ĐẠI DỊCH TẠI VI T NAM, 2009 - 2013 Chuyên ngành: Vi sinh Y học số: ... vi toàn cầu với xuất đại dịch 1.1.1 Đặc điểm vi rút học Phân loại Vi rút cúm thuộc họ Orthomyxoviridae, bao gồm nhóm vi rút: Vi rút cúm A, vi rút cúm B, vi rút cúm C, vi rút Thogoto vi ... phòng chống cúm đồng thời góp phần vào chiến lƣợc phát triển vắc xin cúm Vi t Nam, tiến hành nghiên cứu Một số đặc điểm vi rút học vi rút cúm A/H1N1/09 đại dịch Vi t Nam, 2009 2013 với mục...
  • 158
  • 234
  • 0

Virus cúm A H7N9

Virus cúm A H7N9
... Khái quát virus cúm Virus cúm A/ H7N9 VI RUS CÚM Cúm bệnh truyền nhiễm cấp tính đường hô hấp virus cúm gây Virus cúm có type A, B C Virus dễ bị tiêu diệt nhiệt độ thường có sức sống dai dẳng nhiệt ... cúm A( H7N9) • • • • Tài liệu tham khảo China—WHO Joint Mission on Human Infection with Avian Influenza A( H7N9) Virus 18 – 24 April 2013 Mission Report WHO RISK ASSESSMENT Human infections with avian ... N2…) •VD: Cúm A – H1N1, H5N1, H7N3, H7N7, H7N9, Virus A/ H7N9 Virus cúm H7N9 thực thành viên dòng họ nhà virus cúm gia cầm A Có khả gây nhiễm cho người dẫn đến viêm phổi nặng tiến triển nhanh tỷ...
  • 16
  • 67
  • 0

nôị dung tuyên truyền về phòng chống bệnh cúm a (h5n1) cúm a (h7n9)

nôị dung tuyên truyền về phòng chống bệnh cúm a (h5n1) cúm a (h7n9)
... chống bệnh cúm A (H7N9) Hiện ch a có vắc xin phòng ng a nhiễm cúm A (H7N9) Vì để chủ động phòng chống bệnh cúm A (H7N9) cần thực biện pháp sau: - Tuyên truyền cho người dân bệnh cúm A (H7N9) ... với dịch bệnh - Vệ sinh, khử trùng sẽ chợ bán gia cầm - Buôn bán, vận chuyển gia cầm rõ nguồn gốc II Kiến thức cúm A (H7N9) Vi rút cúm A (H7N9) gì? Vi rút cúm A (H7N9) có nguồn gốc từ gia cầm, ... dụng biện pháp phòng bệnh như: - Khai báo tình trạng sức khoẻ cho quan y tế đ a phương để theo dõi sức khoẻ - Đối với người du lịch đến quốc gia có dịch bệnh cúm A (H5N1), cúm A (H7N9) tổ chức...
  • 4
  • 259
  • 1

ĐÁNH GIÁ một số đặc điểm các TRƯỜNG hợp BỆNH cúm a(h7n9) ở NGƯỜI tại TRUNG QUỐC và đài LOAN từ 29 3 30 4 2013

ĐÁNH GIÁ một số đặc điểm các TRƯỜNG hợp BỆNH cúm a(h7n9) ở NGƯỜI tại TRUNG QUỐC và đài LOAN từ 29 3  30 4 2013
... cỳm A(H7N9) ch yu trung Nam (72,2%) (Biu 3) T ngy 29/ 3/ 20 13 n ngy 30 /4/ 20 13 ó ghi nhn 126 ca mc cỳm A(H7N9) trờn phm vi rng (11 tnh/thnh ph ca Trung Quc v i Loan) (Hỡnh 1) Y HC THC HNH (8 74) ... oỏn v iu tr kp thi KT LUN T ngy 29/ 3/ 20 13 n ngy 30 /4/ 20 13 ó ghi nhn 126 ca mc cỳm A(H7N9) ti 11 tnh/thnh ph phớa ụng ca Trung Quc v i Loan Phn ln cỏc ca mc cỳm A(H7N9) Thng Hi, Giang Tụ, Chit ... Biu 3: phõn b cỏc ca mc cỳm A(H7N9) v t vong theo gii S ca mc cỳm A(H7N9) ch yu Nam (72,2%), t l cht Nam (20,9%) ln hn nhiu N ( 14 ,3% ) n ngy 30 /4/ 20 13 ó ghi nhn cỏc ca mc cỳm A(H7N9) ti...
  • 3
  • 34
  • 0

Tóm tắt luận án nghiên cứu chọn chủng vi rút cúm a h5n1 hiện đang lưu hành tại việt nam tạo được đáp ứng miễn dịch bảo hộ cao trên vịt

Tóm tắt luận án  nghiên cứu chọn chủng vi rút cúm a h5n1 hiện đang lưu hành tại việt nam tạo được đáp ứng miễn dịch bảo hộ cao trên vịt
... hành Nghiên cứu chọn chủng vi rút cúm A/ H5N1 lưu hành Vi t Nam tạo đáp ứng miễn dịch bảo hộ cao vịt Mục tiêu đề tài: Nhằm tiến tới chủ động chế tạo vắc xin phòng bệnh cúm A/ H5N1 thủy cầm (vịt) ... Gene HA vi rút cúm A/ H5N1 - Đáp ứng miễn dịch dịch thể vịt tiêm văc xin vô hoạt từ chủng vi rút cúm A/ H5N1 l a chọn Nội dung (1) Nghiên cứu chọn chủng vi rút để chế tạo văc xin cúm A/ H5N1 - Nghiên ... subtype vi rút cúm A/ H5N1 lưu hành Vi t Nam Để xác định subtype vi rút cúm A/ H5N1 lưu hành Vi t Nam, truy cập genbank quốc tế, tải trình tự gene HA vi rút cúm A/ H5N1 có nguồn gốc từ Vi t Nam, lược...
  • 27
  • 83
  • 0

Trích yếu luận án nghiên cứu chọn chủng vi rút cúm a h5n1 hiện đang lưu hành tại việt nam tạo được đáp ứng miễn dịch bảo hộ cao trên vịt

Trích yếu luận án nghiên cứu chọn chủng vi rút cúm a h5n1 hiện đang lưu hành tại việt nam tạo được đáp ứng miễn dịch bảo hộ cao trên vịt
... học: Thành công đề tài chứng minh khả chọn l a chủng để sản xuất văc xin từ chủng phân lập Vi t Nam, có khả bảo hộ đồng dị clade vi rút cúm A/ H5N1 lưu hành trước đó, mở khả nghiên cứu phân lập tạo ... influenza A/ H5N1 virus isolated from Vietnam; HA Gene of HPAI A/ H5N1, and protective immune response of poultry vaccinated by inactivated vaccine 2.3 Methods Method involved the modem and classical ... step is always selection of vaccine strain and generate a master seed that has to match to the currently circulating strains This study focus on the selection of the Avian influenza virus A/ H5N1...
  • 4
  • 98
  • 0

Kiến thức, thực hành và một số yếu tố liên quan về phòng dịch cúm A(H7N9) của cán bộ kiểm dịch 13 trung tâm kiểm dịch Y tế Quốc tế Việt Nam năm 2014

Kiến thức, thực hành và một số yếu tố liên quan về phòng dịch cúm A(H7N9) của cán bộ kiểm dịch 13 trung tâm kiểm dịch Y tế Quốc tế Việt Nam năm 2014
... cúm A (H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch y tế quốc tế Việt Nam năm 2014 Xác định số y u tố liên quan đến kiến thức, thực hành phòng dịch cúm A(H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch ... Kiến thức, thực hành số y u tố liên quan phòng dịch cúm A(H7N9) cán kiểm dịch 13 Trung tâm Kiểm dịch y tế quốc tế Việt Nam năm 2014 3 MỤC TIÊU NGHIÊN CỨU Mô tả kiến thức, thực hành phòng dịch ... tượng cán kiểm dịch y tế của 13 Trung tâm Kiểm dịch y tế quốc tế nước - Lãnh đạo 13 trung tâm kiểm dịch y tế quốc tế Tiêu chí chọn: kiểm dịch viên y tế công tác Trung tâm Kiểm dịch y tế quốc tế, ...
  • 97
  • 164
  • 0

giám sát sự lưu hành của vi rút cúm a h5n1 ở gia cầm tại các chợ đầu mối trên địa bàn thành phố hà nội

giám sát sự lưu hành của vi rút cúm a h5n1 ở gia cầm tại các chợ đầu mối trên địa bàn thành phố hà nội
... Giám sát lưu hành vi rút Cúm A/ H5N1 gia cầm chợ ñầu mối ñ a bàn thành phố Nội Mục tiêu ñề tài - Xác ñịnh ñược lưu hành vi rút cúm gia cầm chợ buôn bán gia cầm lớn ñ a bàn thành phố Nội - ... chợ ñầu mối ñ a bàn thành phố Nội - Giám sát lưu hành vi rút cúm A/ H5N1 ñàn gia cầm buôn bán chợ ñầu mối ñ a bàn thành phố Nội 2.2 ð a ñiểm nghiên cứu Tại chợ buôn bán gia cầm lớn ñ a bàn ... AGGGCATTTTGGACAAAKCGTCTA Probe TCAACAGTGGCGAGTTCCCTAGCA Xuôi ACGTATGACTACCCGCAGTATTCA Ngược AGACCAGCTACCATGATTGC Probe TGGTCTTGGCCAGACGGTGC Xuôi TGGACTAGTGGGAGCAGCAT Ngược TGTCAATGGTTAAGGGCAACTC HEX BHQ1 FAM BHQ1...
  • 73
  • 92
  • 1

nghiên cứu một số đặc tính sinh học của vi rút cúm a h5n1 clade 7 phân lập ở việt nam

nghiên cứu một số đặc tính sinh học của vi rút cúm a h5n1 clade 7 phân lập ở việt nam
... x a axit amin vị trí cleavage site 71 chủng virus A/ H5N1 clade phân lập Vi t Nam Cây phả hệ d a gen N1 virus A/ H5N1 clade 73 Cây phả hệ d a gen M virus A/ H5N1 clade 79 Kiểm tra ñặc tính gây ngưng ... TRƯỜNG ðẠI HỌC NÔNG NGHIỆP HÀ NỘI NGUYỄN TÙNG NGHIÊN CỨU MỘT SỐ ðẶC TÍNH SINH HỌC C A VI RÚT CÚM A/ H5N1 CLADE PHÂN LẬP VI T NAM CHUYÊN NGÀNH: KÝ SINH TRÙNG VÀ VI SINH VẬT HỌC THÚ Y MÃ SỐ: ... Quốc gia Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Cases Death Ajerbaijan Bangladesh Cambodia China 1 4 2 1 13 4 1 8...
  • 156
  • 36
  • 0

Xem thêm

Từ khóa: những điều cần biết về cúm a h7n9phác đồ điều trị cúm a h7n9điều trị cúm a h7n9hướng dẫn chẩn đoán điều trị cúm a h7n9hướng dẫn điều trị cúm a h7n9hướng dẫn chẩn đoán và điều trị cúm a h7n9phác đồ điều trị cúm a h7n9 của bộ y tếtriệu chứng dịch cúm a h7n9viem duong ho hap cap do vi rut cum a va vi rut cuma h5n1đề thi vi tính bằng a 2011đề thi vi tính bằng a 2012tần số hoán vị gen giữa a và b là 20nghiên cứu đặc điểm dịch tễ học lâm sàng và vi rút học của cúm atính kháng thuốc oseltamivir của virut cúm a lưu hành tại miền bắc việt nam 2001 – 2012vì các đỉnh a b c lần lượt nằm trên các trục ox oy oz nên ta gọi a x 0 0 b 0 y 0 c 0 0 z theo đề g 1 2 là trọng tâm tam giác abc 0 5đ0boi duong hoc sinh gioi tieng viet 5 (danh cho GV và HS tiểu học)Áp dụng hiệp ước vốn basel II kinh nghiệm quốc tế và hàm ý cho việt namNghiên cứu tác động trách nhiệm xã hội của doanh nghiệp đến kết quả hoạt động tài chính tại các ngân hàng thương mại việt namCung sao duong da sieu reBáo cáo tài chính ngân hàng thương mại cổ phần công thương việt nam 2009 q3 hopnhatBáo cáo tài chính ngân hàng thương mại cổ phần công thương việt nam 2010 q4 hopnhatBáo cáo tài chính ngân hàng thương mại cổ phần công thương việt nam 2012 hopnhatBáo cáo tài chính ngân hàng thương mại cổ phần công thương việt nam 2012 q2 hopnhat01 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt chuyen thoai ngoc hau lan 1 nam 2017 8805 1480575571Giáo trình quản trị marketing23 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt tran hung dao lan 2 nam 2017 8930 148393220325 TS247 DT de thi thu thptqg mon hoa truong chuyen khoa hoc tu nhien lan 2 nam 2017 9168 148507981227 TS247 DT de thi thu thpt qg mon hoa truong thpt trieu son 3 thanh hoa lan 1 nam 2017 9087 148454111730 TS247 DT de thi thu thpt qg mon hoa truong thpt hong ngu 2 dong thap lan 1 nam 2017 9132 148523119815 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt han thuyen lan 1 nam 2017 8849 148194727016 TS247 DT de thi thu thpt quoc gia mon hoa hoc so giao duc hung yen lan 1 nam 2017 9084 148307329322 TS247 DT de thi thu thpt qg mon hoa truong thpt chuyen dai hoc su pham ha noi ha noi lan 1 nam 2017 9017 148461935004 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt vinh vien nam 2017 8148 147702392806 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt yen lac 2 lan 1 nam 2017 8775 148049463407 TS247 DT de thi thu thpt quoc gia mon hoa hoc truong thpt chuyen thai binh lan 1 nam 2017 8847 1481707084
Đăng ký
Đăng nhập