0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

A particle swarm optimisation based grey prediction model for thermal error compensation on CNC machine tools

Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Unified Graph Model for Sentence-based Opinion Retrieval" pdf

... approach Section presents a novel unified graph- based model for opinion retrieval We evaluated our model and the results are presented in Section We review related works on opinion retrieval in Section ... query-independent opinion score of all retrieved Unified Opinion Retrieval Model In addition to conventional 2-stage approach, there has been some research on unified opinion retrieval models Eguchi ... degree of each word pair through a graph- based model in the following section 3.2 HITS Model We propose an opinion retrieval model based on HITS, a popular graph ranking algorithm (Kleinberg,...
  • 9
  • 585
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Syntax-Driven Bracketing Model for Phrase-Based Translation" pptx

... minimal then 8: Update bracketing instances for index j 9: end if 10: end if 11: end for 12: for each j ∈ c := ∪ {bracketing instances from j} 13: 14: end for 15: Output: bracketing instances We ... the parse tree 3.3 The Integration of the SDB Model into Phrase-Based SMT We integrate the SDB model into phrase-based SMT to help decoder perform syntax-driven phrase translation In particular, ... training corpus In section we elaborate the syntax-driven bracketing model, including feature generation and the integration of the SDB model into phrase-based SMT In section and 5, we present...
  • 9
  • 438
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Phrase-based Statistical Model for SMS Text Normalization" ppt

... Therefore, the models used in spelling correction are inadequate for providing a complete solution for SMS normalization 2.3 SMS Normalization versus General Text Normalization General text normalization ... pre-processing work for an English-toChinese SMS translation system using a wordgroup model In addition, in most of the commercial SMS translation applications , SMS lingo (i.e., SMS short form) dictionary ... a posteriori distribution for a channel target text given the source text P ( s | e) , and a prior distribution for the channel source text P (e) N ˆ e Phrase-based Model one phrase sk in s ,...
  • 8
  • 399
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Localized Prediction Model for Statistical Machine Translation" ppt

... Probabilistic models for segmenting and labeling sequence data In Proceedings of ICML-01, pages 282289 Franz-Josef Och, Christoph Tillmann, and Hermann Ney 1999 Improved Alignment Models for Statistical Machine ... of support vector machines (SVM) However, Eq is more suitable for non-separable problems (which is often the case for SMT) since it directly models the conditional probability for the candidate ... baseline model (a monotone block sequence is generated) The SWAP model in line uses the same two features, but neighbor blocks can be swapped No performance increase is obtained for this model The...
  • 8
  • 578
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Maximum Entropy Based Phrase Reordering Model for Statistical Machine Translation" docx

... b2 Maximum Entropy Based Reordering Model b1 c1 source In this section, we discuss how to create a maximum entropy based reordering model As described above, we defined the reordering model Ω on ... flexible It makes our model reorder any blocks, observed in training or not The whole maximum entropy based reordering model is embedded inside a log-linear phrase -based model of translation Following ... data, but it binds reorderings to individual concrete phrases, which restricts the model to reorderings of phrases seen in training data On the contrary, the MaxEnt -based reordering model is not limited...
  • 8
  • 390
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Syllable Based Word Recognition Model for Korean Noun Extraction" potx

... conjugated forms of verbs Syllable statistics have been also used for automatic word spacing (Shim, 1996; Kang and Woo, 2001; Lee et al., 2002) The syllable based word recognition model is represented ... data suitable for the word recognition model The corpus can be modied through the following steps: Step For a given Eojeol, segment word boundaries and assign word tags to each word í í ... word because it is an uninected morpheme Â Ê ể Ư ể ƯỉĐ ể ể ỉ Đ Đ ọ ỉ Syllable based word recognition model A Korean syllable consists of an obligatory onset (initial-grapheme, consonant),...
  • 8
  • 368
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Novel Burst-based Text Representation Model for Scalable Event Detection" pptx

... compare the performance of different text representation models for event detection, namely BurstVSM and boostVSM (He et al., 2007b; He et al., 2007a).7 For different representation models, we use ... proposed methods are both effective and efficient Burst-based Text Representation In this section, we describe the proposed burst-based text representation model, denoted as BurstVSM In BurstVSM, each ... clusters as events This algorithm can run a mutli-thread mode to speed up processing Our contribution can be summarized as two aspects: 1) we propose a novel burst-based text representation model, ...
  • 5
  • 1,126
  • 0
Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

Báo cáo khoa học: A fluorescence energy transfer-based mechanical stress sensor for specific proteins in situ pdf

... 5Â-CCTGGATTTTCTGACCAATTTTT TTAAGTCGTAAGCGCTTGCGC-3Â; 2.5I sense primer, 5Â-GAAACAAGATTAAAGAAAAGAAAATTTAGAAAC AAGATTAAAGAAAAGCTTAAAAAAATTGGTCAGA AAATC-3Â; 2.5I antisense primer, 5Â-GATTTTCTGAC CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ... claim to original US government works F Meng et al AAAATTTAGAAACAAGATTAAAGAAAAGCTTAAA AAAATTGGTCAGAAAATCCAGGGTTTCGTGCCGAA ACTTGCAGGTGT-3Â, was synthesized by Operon (Huntsville, Alabama, USA) and ... CAATTTTTTTAAGCTTTTCTTTAATCTTGTTTCTAA ATTTTCTTTTCTTTAATCTTGTTTC-3Â; FT1AA sense primer, 5Â-GATTAAAGAAAAGCTTAAAATTGGTCA GAAAATCC-3Â; FT1AA antisense primer, 5Â-GGA TTTTCTGACCAATTTTAAGCTTTTCTTTAATC-3Â;...
  • 16
  • 329
  • 0
báo cáo hóa học:

báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot

... Acknowledgements We are grateful to Drs David Wenkert and Yuehai Shen for 17AAG characterization and to Drs Jacob Zhang and Kyle Furge for statistical analysis We thank Michelle Bassett for assistance in ... highly invasive into the brain parenchyma and rarely fully resectable Xenograft mouse models for human GBM inadequately recapitulate the human disease because of slow growth and invasion at the ... test was used for comparison of 17AAG treatments against DBM2 pulmonary metastases Results GBM tumor cells have metastatic potential Primary and metastatic brain tumors are often aggressive and...
  • 13
  • 413
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

... monopole antenna using a particle swarm optimization approach,” IEEE Transactions on Antennas and Propagation, vol 53, no 10, pp 1–7, 2005 [24] J Robinson and Y Rahmat-Samii, Particle swarm optimization ... Ho, A S Madhukumar, and F Chin, “Peak-to-average power reduction using partial transmit sequences: a suboptimal approach based on dual layered phase sequencing,” IEEE Transactions on Broadcasting, ... 16, and 32 100 Pr (PAPR > PAPR0 ) a generation Gn = 40, we can see that the PSO -based PTS technique is capable of attaining a near OPTS technique performance, when Pr (PAPR > PAPR0 ) = 10−3 In...
  • 8
  • 406
  • 0
situation of using clinical services and effectiveness of health care model for elderly people rely on medical facilities in binh duong

situation of using clinical services and effectiveness of health care model for elderly people rely on medical facilities in binh duong

... use of medical services for elderly people and ability to meet of commune health stations in Binh Duong Province, 2010 4.1.1 On the demand, access to and use of medical services for elderly people ... meet of commune health centers in Binh Duong province, in 2010 - Health care needs of elderly people in Binh Duong Province were quite high: Estimate of the frequency of sick elderly people in ... Assessing the effectiveness of health care model for elderly people rely on facility health in Binh Duong province (2010-2011) * The new contribution of the thesis: - Described the situation demands,...
  • 31
  • 332
  • 0
báo cáo khoa học:

báo cáo khoa học: "An evidence-based health workforce model for primary and community care" pot

... of the model for those seeking an evidence-based approach to health workforce and health services planning The South Australian Department of Health is already using the WEB model to inform the ... article as: Segal and Leach: An evidence-based health workforce model for primary and community care Implementation Science 2011 6:93 Submit your next manuscript to BioMed Central and take full advantage ... new approach to health workforce planning Segal et al [17] recently described a needs-based workforce planning framework for estimating the health workforce team (i.e., skill mix and hours) required...
  • 8
  • 263
  • 0
Báo cáo y học:

Báo cáo y học: " A local glucose-and oxygen concentration-based insulin secretion model for pancreatic islets Peter Buchwald" potx

... Endocrinol Metab 2003, 88:742-747 72 Nomura M, Shichiri M, Kawamori R, Yamasaki Y, Iwama N, Abe H: A mathematical insulin- secretion model and its validation in isolated rat pancreatic islets perifusion ... comparison Oxygen dependence Because oxygen diffusion is a limiting factor in avascular islets, hypoxia can limit insulin secretion The oxygen dependence of local insulin release has been parameterized ... to indicate that insulin release decreases nonlinearly with decreasing oxygen availability; however, only relatively few detailed concentration-dependence studies are available Parametrization...
  • 25
  • 296
  • 0
Line field based adaptive image model for blind deblurring

Line field based adaptive image model for blind deblurring

... construct an adaptive image model based on the line field model  To examine the proposed model s performance for image restoration by using it for the denoising problem  To solve the deblurring ... variant distributed line field is called LiFeAIM, which stands for Line Field based Adaptive Image Model We use the model in a denoising algorithm to examine its goodness in image restoration The ... 34 3.2 Markov random field and image modeling 37 3.3 Line field with variant distribution 39 3.4 Line- Field based Adaptive Image Model (LiFeAIM) 42 3.5 Denoising...
  • 163
  • 181
  • 0
The application of ANFIS prediction models for thermal error compensation on CNC machine tools

The application of ANFIS prediction models for thermal error compensation on CNC machine tools

... prediction model One of the difficult issues in thermal error modelling is the selection of appropriate locations for the temperature sensors, which is a key factor in the accuracy of the thermal error ... discussion In this section, the aim is to use the structure of the ANFIS models described in the previous section to derive a thermal error compensation system With the purpose of evaluating the prediction ... study of ANN and ANFIS prediction models for thermal error compensation on CNC machine tools, in: Laser Metrology and Machine Performance X, Buckinghamshire, 2013, pp 79–88 [9] J.-H Lee, et al., Thermal...
  • 11
  • 335
  • 0

Xem thêm

Từ khóa: a prediction model for survivalphrase based joint probability model for statistical machine translationmaximum entropy based phrase reordering model for statistical machine translationa game theoretic approach based adaptive control design for sequentially interconnected siso lina syllable based word recognition modela localized prediction modela topic based coherence model for statistical machine translationon line chemistry within wrf description and evaluation of a state of the art multiscale air quality and weather prediction modela multiagent fuzzy neuro network based weather prediction systemcontrolling particle size in ress a simpli ed model for nucleation and condensationminimal particle based coarse grained model discretization of space and molecular contoura comprehensive conceptual model for multi level management of cloud based systemsmobility diffusion coefficient and density of charge carriers in ionic liquids and novel electrolytes based on a new model for dielectric responsekinematics of a particlea novel model for global customerBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ