a novel model for global customer

Team Risk Management: A New Model for Customer- Supplier Relationships doc

Ngày tải lên : 23/03/2014, 23:21

30
521
0

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Ngày tải lên : 19/02/2014, 19:20

... system learns this as a non-transliteration but it is wrongly annotated as a transliteration in the gold standard. Arabic nouns have an article “al” attached to them which is translated in English as ... uses Hidden Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Au- tomata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... International Language Resources and Evaluation (LREC’10), Val- letta, Malta. Sittichai Jiampojamarn, Kenneth Dwyer, Shane Bergsma, Aditya Bhargava, Qing Dou, Mi-Young Kim, and Grzegorz Kondrak....

9
521
0

Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt

Ngày tải lên : 07/03/2014, 03:20

... thickness; Phenomenex, Aschaffenburg, Germany). The temperature program used was as follows: 50 °C held isocratically for 5 min, followed by a ramp of 25 °CÆmin )1 to a ﬁnal A novel route for geranial formation A. ... of carotenoids. Abbreviations CCD, carotenoid cleavage dioxygenase; GST, glutathione S-transferase; NIST, National Institute of Standards and Technology; OsCCD1, Oryza sativa carotenoid cleavage ... (1999) Co-oxidation of b-carotene catalyzed by soybean and recombinant pea lipoxygen- ases. J Agric Food Chem 47, 4899–4906. A. Ilg et al. A novel route for geranial formation FEBS Journal 276 (2009)...

12
497
0

Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt

Ngày tải lên : 07/03/2014, 21:20

... available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor do they parallel the ﬁndings on the noncanonical class IIIc AC Rv1900c [14]. Another novel ... non- conservative manner, glutamine-asparagine instead of lysine-aspartate. All mammalian membrane-bound ACs possess a strictly conserved and spaced hexad of catalytic residues. Emerging from mostly bacterial ... the canonical transition-state stabilizing asparagine does not contact the substrate and mutagenesis shows that it appears not to be involved in catalysis. Furthermore the asparagine-aspartate...

8
401
0

Báo cáo khoa học: A mouse model for in vivo tracking of the major dust mite allergen Der p 2 after inhalation docx

Ngày tải lên : 07/03/2014, 21:20

... day 30 displayed an airway inflammation 18 h after treatment, in the same magni- tude as in animals challenged with a third HDM aero- sol on day 30 (data not shown). The animals were killed after ... using a PhosphorImager with the image quant software (both from Molecular Dynamics, Sunnyvale, CA, USA). As standards for SDS ⁄ PAGE autoradiography, 75 Se-labelled recombinant rat TrxR1 [41] and ... dust mite Dermatophagoides farinae augments proinflammatory mediator productions and accessory function of alveolar macrophages: implications for allergic sensitization and inflammation. J Immunol...

12
518
0

Báo cáo khoa học: "A Probabilistic Model for Fine-Grained Expert Search" pptx

Ngày tải lên : 08/03/2014, 01:20

... query expansion (Macdonald and Ounis, 2007), hierarchical language model (Petkova and Croft, 2006), and for- mal model generation (Balog et al., 2006; Fang et al., 2006). However, all of them ... behind the quadruple is that a query may be matched with phrases in various forms (denoted as topic here) and an expert candidate may appear with various name masks (denoted as person here), ... Alias, new email (N AE ) 7% / 0.4600 Ritiwari rti- wari@hotmail.com Table 1. Various masks and their ambiguity 1) Every occurrence of a candidate’s email address is normalized to the appropriate...

9
399
0

Báo cáo khoa học: "A Bayesian Model for Discovering Typological Implications" ppt

Ngày tải lên : 08/03/2014, 02:21

... of all possible language/feature pairs are known. A sample of ﬁve languages and six features from the database are shown in Table 1. Importantly, the density of samples is not random. For certain ... Furthermore, some features are known for many languages. This is due to the fact that certain features take less effort to identify than others. Identifying, for instance, if a language has a particular set ... them are Indo-European and the other half are Austronesian. We will use a nearly identical model to the FLAT model, but instead of having a single m variable, we have three: one for IE, one for Austronesian...

8
471
0

Báo cáo khoa học: "Grammar Approximation by Representative Sublanguage: A New Model for Language Learning" potx

Ngày tải lên : 08/03/2014, 02:21

... generalization steps Figure 2: Example of a simple grammar lattice. All grammars generate , and only generates ( is a common lexicon for all the grammars) 3 A Grammar Lattice as a Search Space for ... USA rambow@cs.columbia.edu Abstract We propose a new language learning model that learns a syntactic-semantic grammar from a small number of natural language strings annotated with their semantics, ... 832–839, Prague, Czech Republic, June 2007. c 2007 Association for Computational Linguistics Grammar Approximation by Representative Sublanguage: A New Model for Language Learning Smaranda Muresan Institute...

8
402
0

Báo cáo khoa học: "A Sequencing Model for Situation Entity Classiﬁcation" pdf

Ngày tải lên : 08/03/2014, 02:21

... verb HASMODAL T if clause contains modal verb FREQADV T if clause contains frequency adverb MODALADV T if clause contains modal adverb VOLADV T if clause contains volitional adverb FIRSTVB lexical ... for a rule-based model. Our models handle the defeasibility of these correlations probabilistically, as is standard for machine learning for natural language processing. 899 2 Discourse modes and ... a derived situation type. For example, a modal adverb can trigger aspectual coercion: (6) Mickey probably paints houses. (P) Serious challenges for SE classiﬁcation arise from the aspectual ambiguity...

8
458
0

Báo cáo khoa học: "A Morphographemic Model for Error Correction Nonconcatenative Strings" pot

Ngày tải lên : 08/03/2014, 07:20

... takattab tukuttib 6 takaatab tukuutib 7 nkatab nkutib 8 ktatab ktutib 9 ktabab 10 staktab stuktib 11 ktaabab 12 ktawtab 13 ktawwab 14 ktanbab 15 ktanbay Q1 dahraj duhrij Q2 tadahraj ... Forms kadi~ kud~, *kidaa~ kaafil kuffal, *kufalaa~, *kuffaal kaffil kufalaaP sahm *Pashaam, suhuum, Pashum Patterns marked with * are morphologically plausi- ble, but do not occur lexically ... error is that conso- nant substitution may not take place before append- ing a suffix. For example/samaaP/'heaven' + {iyy) 'relative adjective' surfaces as (samaawiyy), where...

7
451
0

Báo cáo khoa học: "A Statistical Model for Lost Language Decipherment" pptx

Ngày tải lên : 17/03/2014, 00:20

... this research has similar goals, it typically builds on information or resources unavailable for ancient texts, such as comparable corpora, a seed lexicon, and cognate information (Fung and McKe- own, ... 2010. c 2010 Association for Computational Linguistics A Statistical Model for Lost Language Decipherment Benjamin Snyder and Regina Barzilay CSAIL Massachusetts Institute of Technology {bsnyder,regina}@csail.mit.edu Kevin ... technique for imposing structural sparsity constraints on character-level mappings. We assume that an ac- curate alphabetic mapping between related languages will be sparse in the following way: each letter...

10
429
0

Báo cáo khoa học: "A Discriminative Model for Joint Morphological Disambiguation and Dependency Parsing" ppt

Ngày tải lên : 17/03/2014, 00:20

... annotations. 890 UNIGRAM CASE− UNIGRAM CASE− CASE− LINK CASE− LINK CASE− LINK CASE− LINK CASE 6,gen CASE 3,gen CASE 3,nom 3,acc CASE UNIGRAM CASE− UNIGRAM CASE− UNIGRAM CASE− CASE 2, CASE LINK CASE 6,acc CASE− BIGRAM CASE− BIGRAM TREE WORD− LINK WORD LINK CASE ... neighboring variables are 4 Variables for link labels can be integrated in a straightfor- ward manner, if desired. true and it evaluates to a non-negative real number; otherwise, it evaluates to 1 and ... pipeline parser. For adjectives, the example shown in Table 1 and Figure 1 is a typical sce- nario, where an accusative adjective was tagged as nominative, and was then misanalyzed by the parser as...

10
411
0

Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc

Ngày tải lên : 22/03/2014, 17:20

... (P.B. and P.B.) have used Ruta 6 and Ca 3 (PO 4 ) 2 combination therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, ... intracranial brain cancers. The 15 patients (9 male, 6 female) with intracranial brain cancers who were treated with Ruta 6 + Ca 3 (PO 4 ) 2 at the PBH Research Foundation, Kolkata, India, had ... the rodent model. J Agr Food Chem 47: 1078-1082, 1999. 16. Afanas'ev IB, Ostrakhovitch EA, Mikhal'chick EV, Ibragimova GA and Korkina LG: Enhancement of antioxidant and anti-inflammatory activities...

8
670
0

**The Privatization of Italian Savings Banks – A Role Model for Germany?* doc**

Ngày tải lên : 22/03/2014, 21:20

... industriale), which was a public holding company containing the three largest private banks (Banca Commerciale Italiana, Credito Italiano, and Banca di Roma) and a large number of public banks (Körnert ... special status easily. Apart from legal considerations, the main arguments brought forward against the privatization of the savings banks are threefold. First, only the savings banks can guarantee ... Modena) Credito Italiano Group UniCredito SpA Privatization Credito Italiano Credito Romagnolo Banking Group (Emilia Romagna, Bologna), later Rolo Banca 1473 Banca CRT (Cassa di Risparmio di Turino) Cariverona (Cassa...

19
469
0

Báo cáo khoa học: Differential expression of liver and kidney proteins in a mouse model for primary hyperoxaluria type I pdf

Ngày tải lên : 23/03/2014, 03:20

... short chain; Aco1, aconitase 1; Agt ) , alanine-glyoxylate aminotransferase knockout; Aldh2, aldehyde dehydrogenase 2; Car3, carbonic anhydr- ase 3; Cat, catalase; Dao1, D-amino acid oxidase 1; ... Coomassie blue R-250 for preparative gels [11] or silver nitrate for analyti- cal gels [12]. Image capture and analysis Gels were scanned using a UMAX scanner (Amersham Biosciences, Barcelona, ... Wang X, Santana A, Roy-Chowdhury N, Torres A, Shapiro LJ & Roy-Chowdhury J (2006) Alanine-glyoxylate aminotransferase-deﬁcient mice, a model for primary hyperoxaluria that responds to adenoviral...

9
481
0

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Ngày tải lên : 23/03/2014, 13:20

... ATTAAGGAGCTTCGGGAGATG Exon 7 380 P558 CTCTTATACCCAATGCTGCTG Exon 10 CYP1 1A First pair P561 GCCTTTGAGTCCATCACTAAC Exon 4 628 P562 CCAGTGTCTTGGCAGGAATC Exon 8 Nested pair P563 ATGTGGCTGCATGGGACGTG ... control placenta, whole human skin, normal epidermal and immor- talized keratinocytes, dermal ﬁbroblasts, squamous cell carcinoma and ﬁve human melanomas. Thus, these data clarify in detail the cutaneous ... 390 P564 TCTGCAGGGTCACGGAGATG Exon 7 Mouse genes FDX1 P581 AAATTGGCGACTCTCTGCTAG Exon 2 295 P582 CTTGCTCATGTCAACAGACTG Exon 4 FDXR P583 CTTGGAGTCATCCCCAACAC Exon 10 281 P584 TGGCCTCGAGAGACTTCCTC Exon...